After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Rat CHODL Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Rat CHODL cDNA Clone Product Information
NCBI RefSeq:NM_001105894.1
RefSeq ORF Size:957bp
cDNA Description:Full length Clone DNA of Rattus norvegicus chondrolectin.
Gene Synonym:Chodl
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
References
  • Weng L, et al. (2003) A novel alternative spliced chondrolectin isoform lacking the transmembrane domain is expressed during T cell maturation. J Biol Chem. 278(21): 19164-70.
  • Masuda K, et al. (2011) Chondrolectin is a novel diagnostic biomarker and a therapeutic target for lung cancer. Clin Cancer Res. 17(24): 7712-22.
  • Weng L, et al. (2002) Molecular cloning and characterization of human chondrolectin, a novel type I transmembrane protein homologous to C-type lectins. Genomics. 80(1): 62-70.
  • Size / Price
    Catalog: RG80396-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"