After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat CHODL Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Rat CHODL cDNA Clone Product Information
NCBI RefSeq:NM_001105894.1
RefSeq ORF Size:957bp
cDNA Description:Full length Clone DNA of Rattus norvegicus chondrolectin with C terminal His tag.
Gene Synonym:Chodl
Species:Rat
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
References
  • Weng L, et al. (2003) A novel alternative spliced chondrolectin isoform lacking the transmembrane domain is expressed during T cell maturation. J Biol Chem. 278(21): 19164-70.
  • Masuda K, et al. (2011) Chondrolectin is a novel diagnostic biomarker and a therapeutic target for lung cancer. Clin Cancer Res. 17(24): 7712-22.
  • Weng L, et al. (2002) Molecular cloning and characterization of human chondrolectin, a novel type I transmembrane protein homologous to C-type lectins. Genomics. 80(1): 62-70.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"