CHMP1A cDNA ORF Clone, Rat, N-His tag

Cat: RG80487-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CHMP1A Reagents
CRO Services
Product recommended

All CHMP1A Reagents
CHMP1A cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
591 bp
Description
Full length Clone DNA of Rat charged multivesicular body protein 1A with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CHMP1A Background Information
Full Name
charged multivesicular body protein 1A

CHMP1A cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CHMP1A cDNA ORF Clone in Cloning Vector, Rat RG80487-U
CHMP1A cDNA ORF Clone, Rat, untagged RG80487-UT
CHMP1A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80487-ACGLN
CHMP1A cDNA ORF Clone, Rat, C-GFPSpark® tag RG80487-ACG
CHMP1A cDNA ORF Clone, Rat, N-GFPSpark® tag RG80487-ANG
CHMP1A cDNA ORF Clone, Rat, C-OFPSpark® tag RG80487-ACR
CHMP1A cDNA ORF Clone, Rat, N-OFPSpark® tag RG80487-ANR
CHMP1A cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80487-CF
CHMP1A cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80487-NF
CHMP1A cDNA ORF Clone, Rat, C-His tag RG80487-CH
CHMP1A cDNA ORF Clone, Rat, C-HA tag RG80487-CY
CHMP1A cDNA ORF Clone, Rat, N-HA tag RG80487-NY
CHMP1A cDNA ORF Clone, Rat, C-Myc tag RG80487-CM
CHMP1A cDNA ORF Clone, Rat, N-Myc tag RG80487-NM
CHMP1A qPCR Primer Pairs, Rat RP300451

CHMP1A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CHMP1A cDNA ORF Clone in Cloning Vector, Human HG15569-G
CHMP1A cDNA ORF Clone, Human, untagged HG15569-UT
CHMP1A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15569-ACGLN
CHMP1A cDNA ORF Clone, Human, C-GFPSpark® tag HG15569-ACG
CHMP1A cDNA ORF Clone, Human, N-GFPSpark® tag HG15569-ANG
CHMP1A cDNA ORF Clone, Human, C-OFPSpark® tag HG15569-ACR
CHMP1A cDNA ORF Clone, Human, N-OFPSpark® tag HG15569-ANR
CHMP1A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15569-CF
CHMP1A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15569-NF
CHMP1A cDNA ORF Clone, Human, C-His tag HG15569-CH
CHMP1A cDNA ORF Clone, Human, N-His tag HG15569-NH
CHMP1A cDNA ORF Clone, Human, C-HA tag HG15569-CY
CHMP1A cDNA ORF Clone, Human, N-HA tag HG15569-NY
CHMP1A cDNA ORF Clone, Human, C-Myc tag HG15569-CM
CHMP1A cDNA ORF Clone, Human, N-Myc tag HG15569-NM
CHMP1A qPCR Primer Pairs, Human HP104189
info info
添加购物车成功! 添加购物车失败!