CHCHD10 cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81339-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CHCHD10 Reagents
CRO Services
Product recommended

All CHCHD10 Reagents
CHCHD10 cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
417 bp
Description
Full length Clone DNA of Rat coiled-coil-helix-coiled-coil-helix domain containing 10 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CHCHD10 Background Information
Full Name
coiled-coil-helix-coiled-coil-helix domain containing 10

CHCHD10 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CHCHD10 cDNA ORF Clone in Cloning Vector, Rat RG81339-G
CHCHD10 cDNA ORF Clone, Rat, untagged RG81339-UT
CHCHD10 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81339-ACGLN
CHCHD10 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81339-ACG
CHCHD10 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81339-ANG
CHCHD10 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81339-ACR
CHCHD10 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81339-ANR
CHCHD10 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81339-NF
CHCHD10 cDNA ORF Clone, Rat, C-His tag RG81339-CH
CHCHD10 cDNA ORF Clone, Rat, N-His tag RG81339-NH
CHCHD10 cDNA ORF Clone, Rat, C-HA tag RG81339-CY
CHCHD10 cDNA ORF Clone, Rat, N-HA tag RG81339-NY
CHCHD10 cDNA ORF Clone, Rat, C-Myc tag RG81339-CM
CHCHD10 cDNA ORF Clone, Rat, N-Myc tag RG81339-NM
CHCHD10 qPCR Primer Pairs, Rat RP301285

CHCHD10 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CHCHD10 cDNA ORF Clone in Cloning Vector, Mouse MG5A2428-U
CHCHD10 cDNA ORF Clone, Mouse, untagged MG5A2428-UT
CHCHD10 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2428-ACG
CHCHD10 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2428-ACGLN
CHCHD10 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A2428-ANG
CHCHD10 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A2428-ACR
CHCHD10 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A2428-ANR
CHCHD10 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A2428-CF
CHCHD10 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A2428-NF
CHCHD10 cDNA ORF Clone, Mouse, C-His tag MG5A2428-CH
CHCHD10 cDNA ORF Clone, Mouse, N-His tag MG5A2428-NH
CHCHD10 cDNA ORF Clone, Mouse, C-HA tag MG5A2428-CY
CHCHD10 cDNA ORF Clone, Mouse, N-HA tag MG5A2428-NY
CHCHD10 cDNA ORF Clone, Mouse, C-Myc tag MG5A2428-CM
CHCHD10 cDNA ORF Clone, Mouse, N-Myc tag MG5A2428-NM

CHCHD10 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CHCHD10 cDNA ORF Clone in Cloning Vector, Human HG26639-U
CHCHD10 cDNA ORF Clone, Human, untagged HG26639-UT
CHCHD10 cDNA ORF Clone, Human, C-GFPSpark® tag HG26639-ACG
CHCHD10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG26639-ACGLN
CHCHD10 cDNA ORF Clone, Human, N-GFPSpark® tag HG26639-ANG
CHCHD10 cDNA ORF Clone, Human, C-OFPSpark® tag HG26639-ACR
CHCHD10 cDNA ORF Clone, Human, N-OFPSpark® tag HG26639-ANR
CHCHD10 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG26639-CF
CHCHD10 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG26639-NF
CHCHD10 cDNA ORF Clone, Human, C-His tag HG26639-CH
CHCHD10 cDNA ORF Clone, Human, N-His tag HG26639-NH
CHCHD10 cDNA ORF Clone, Human, C-HA tag HG26639-CY
CHCHD10 cDNA ORF Clone, Human, N-HA tag HG26639-NY
CHCHD10 cDNA ORF Clone, Human, C-Myc tag HG26639-CM
CHCHD10 cDNA ORF Clone, Human, N-Myc tag HG26639-NM
info info
添加购物车成功! 添加购物车失败!