Quick Order

Text Size:AAA

Rat cofilin 2/CFL2 Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Rat CFL2 cDNA Clone Product Information
NCBI RefSeq:NM_001108982.2
RefSeq ORF Size:501bp
cDNA Description:Full length Clone DNA of Rattus norvegicus cofilin 2, muscle with C terminal Flag tag.
Gene Synonym:Cfl2
Species:Rat
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Cofilin 2 (muscle), also known as CFL2, is a member of cofilin family of the actin-binding protein superfamily. Cofilin2 shows significant homology to the other two members: cofilin 1 and DSTN, through its entire sequence, and contains residues conserved among the cofilin family that are responsible for actin-binding. Cofilin 2 (CFL2) is an important regulator of striated myocyte function. Purified cofilin 2 depolymerized actin filaments in a dose- and pH-dependent manner and reduced the apparent viscosity of an actin solution, although they did not co-sediment with actin filaments at all. Cofilin2 is not expressed in vegetative cells, but is transiently induced during the aggregation stage of development, whereas cofilin 1 was predominantly expressed in vegetative cells. 

References
  • Aizawa H, et al. (2001) Cofilin-2, a novel type of cofilin, is expressed specifically at aggregation stage of Dictyostelium discoideum development. Genes Cells. 6 (10): 913-21.
  • Papalouka V, et al. (2009) Muscle LIM protein interacts with cofilin 2 and regulates F-actin dynamics in cardiac and skeletal muscle. Papalouka V, Mol Cell Biol. 29 (22): 6046-58.
  • Size / Price
    Catalog: RG81236-CF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"