CEL cDNA ORF Clone, Rat, C-Myc tag

Cat: RG81233-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CEL Reagents
CRO Services
Product recommended

All CEL Reagents
CEL cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1839 bp
Description
Full length Clone DNA of Rat carboxyl ester lipase with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CEL Background Information
Full Name
carboxyl ester lipase

CEL cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CEL cDNA ORF Clone in Cloning Vector, Rat RG81233-U
CEL cDNA ORF Clone, Rat, untagged RG81233-UT
CEL Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81233-ACGLN
CEL cDNA ORF Clone, Rat, C-GFPSpark® tag RG81233-ACG
CEL cDNA ORF Clone, Rat, C-OFPSpark® tag RG81233-ACR
CEL cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81233-CF
CEL cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81233-NF
CEL cDNA ORF Clone, Rat, C-His tag RG81233-CH
CEL cDNA ORF Clone, Rat, N-His tag RG81233-NH
CEL cDNA ORF Clone, Rat, C-HA tag RG81233-CY
CEL cDNA ORF Clone, Rat, N-HA tag RG81233-NY
CEL cDNA ORF Clone, Rat, N-Myc tag RG81233-NM
CEL qPCR Primer Pairs, Rat RP301189

CEL cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CEL cDNA ORF Clone in Cloning Vector, Mouse MG50583-M
CEL cDNA ORF Clone, Mouse, untagged MG50583-UT
CEL cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50583-ACG
CEL Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50583-ACGLN
CEL cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50583-ACR
CEL cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50583-CF
CEL cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50583-NF
CEL cDNA ORF Clone, Mouse, C-His tag MG50583-CH
CEL cDNA ORF Clone, Mouse, N-His tag MG50583-NH
CEL cDNA ORF Clone, Mouse, C-HA tag MG50583-CY
CEL cDNA ORF Clone, Mouse, N-HA tag MG50583-NY
CEL cDNA ORF Clone, Mouse, C-Myc tag MG50583-CM
CEL cDNA ORF Clone, Mouse, N-Myc tag MG50583-NM
CEL qPCR Primer Pairs, Mouse MP200575

CEL cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CEL cDNA ORF Clone, Human, untagged HG17918-UT
info info
添加购物车成功! 添加购物车失败!