CEACAM11 cDNA ORF Clone, Rat, C-His tag

Cat: RG81146-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CEACAM11 Reagents
CRO Services
Product recommended

All CEACAM11 Reagents
CEACAM11 cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
906 bp
Description
Full length Clone DNA of Rat carcinoembryonic antigen-related cell adhesion molecule 11 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CEACAM11 Background Information
Full Name
carcinoembryonic antigen-related cell adhesion molecule 11

CEACAM11 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CEACAM11 cDNA ORF Clone in Cloning Vector, Rat RG81146-U
CEACAM11 cDNA ORF Clone, Rat, untagged RG81146-UT
CEACAM11 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81146-ACG
CEACAM11 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81146-ACGLN
CEACAM11 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81146-ANG
CEACAM11 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81146-ACR
CEACAM11 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81146-ANR
CEACAM11 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81146-CF
CEACAM11 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81146-NF
CEACAM11 cDNA ORF Clone, Rat, N-His tag RG81146-NH
CEACAM11 cDNA ORF Clone, Rat, C-HA tag RG81146-CY
CEACAM11 cDNA ORF Clone, Rat, N-HA tag RG81146-NY
CEACAM11 cDNA ORF Clone, Rat, C-Myc tag RG81146-CM
CEACAM11 cDNA ORF Clone, Rat, N-Myc tag RG81146-NM
CEACAM11 qPCR Primer Pairs, Rat RP301102

CEACAM11 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CEACAM11 cDNA ORF Clone in Cloning Vector, Mouse MG53215-G
CEACAM11 cDNA ORF Clone, Mouse, untagged MG53215-UT
CEACAM11 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53215-ACGLN
CEACAM11 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53215-ACG
CEACAM11 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53215-ANG
CEACAM11 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53215-ACR
CEACAM11 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53215-ANR
CEACAM11 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53215-CF
CEACAM11 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53215-NF
CEACAM11 cDNA ORF Clone, Mouse, C-His tag MG53215-CH
CEACAM11 cDNA ORF Clone, Mouse, N-His tag MG53215-NH
CEACAM11 cDNA ORF Clone, Mouse, C-HA tag MG53215-CY
CEACAM11 cDNA ORF Clone, Mouse, N-HA tag MG53215-NY
CEACAM11 cDNA ORF Clone, Mouse, C-Myc tag MG53215-CM
CEACAM11 cDNA ORF Clone, Mouse, N-Myc tag MG53215-NM
info info
添加购物车成功! 添加购物车失败!