Quick Order

Text Size:AAA

Rat VE-Cadherin/CD144 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Rat CDH5 cDNA Clone Product Information
NCBI RefSeq:NM_001107407.1
RefSeq ORF Size:2331bp
cDNA Description:Full length Clone DNA of Rattus norvegicus cadherin 5.
Gene Synonym:Cdh5
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Cadherins (Calcium dependent adhesion molecules) are a class of transmembrane proteins. Cadherin-5, also known as VE-cadherin, CDH5 and CD144, an endothelial specific cell-cell adhesion molecule, plays a pivotal role in the formation, maturation and remodeling of the vascular wall. VE-Cadherin is widely considered to be specific for vascular endothelia in which it is either the sole or the predominant cadherin, often co-existing with N-cadherin. This specificity of VE-cadherin for vascular endothelial cells is important not only in blood and lymph vessel biology and medicine, but also for cell-type-based diagnoses, notably those of metastatic tumors. As a classical cadherin, VE-Cadherin links endothelial cells together by homophilic interactions mediated by its extracellular part and associates intracellularly with the actin cytoskeleton via catenins. Mechanisms that regulate VE-cadherin-mediated adhesion are important for the control of vascular permeability and leukocyte extravasation. In addition to its adhesive functions, VE-Cadherin regulates various cellular processes such as cell proliferation and apoptosis and modulates vascular endothelial growth factor receptor functions. Consequently, VE-cadherin is essential during embryonic angiogenesis.

References
  • Taveau JC, et al. (2008) Structure of artificial and natural VE-cadherin-based adherens junctions. Biochem Soc Trans. 36(Pt 2): 189-93.
  • Vestweber D. (2008) VE-cadherin: the major endothelial adhesion molecule controlling cellular junctions and blood vessel formation. Arterioscler Thromb Vasc Biol. 28(2): 223-32.
  • Gavard J. (2009) Breaking the VE-cadherin bonds. FEBS Lett. 583(1): 1-6.
  • Vestweber D, et al. (2009) Cell adhesion dynamics at endothelial junctions: VE-cadherin as a major player. Trends Cell Biol. 19(1): 8-15.
  • Boda-Heggemann J, et al. (2009) Beyond vessels: occurrence and regional clustering of vascular endothelial (VE-)cadherin-containing junctions in non-endothelial cells. Cell Tissue Res. 335(1): 49-65.
  • Size / Price
    Catalog: RG80276-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"