N Cadherin cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG80275-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All N Cadherin Reagents
CRO Services

All N Cadherin Reagents
N Cadherin cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2721 bp
Description
Full length Clone DNA of Rat cadherin 2 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

N Cadherin Background Information

Cadherins are calcium dependent cell adhesion proteins, and they preferentially interact with themselves in a homophilic manner in connecting cells. Cadherin 2 (CDH2), also known as N-Cadherin (neuronal) (NCAD), is a single-pass tranmembrane protein and a cadherin containing 5 cadherin domains. N-Cadherin displays a ubiquitous expression pattern but with different expression levels between endocrine cell types. CDH2 (NCAD) has been shown to play an essential role in normal neuronal development, which is implicated in an array of processes including neuronal differentiation and migration, and axon growth and fasciculation. In addition, N-Cadherin expression was upregulated in human HSC during activation in culture, and function or expression blocking of N-Cadherin promoted apoptosis. During apoptosis, N-Cadherin was cleaved into 20-100 kDa fragments. It may provide a novel target for therapies that are directed toward intimal proliferative disorders, including restenosis and vascular bypass graft failure. N-Cadherin is associated with tumor aggressiveness and metastatic potential and may contribute to tumor progression.

Full Name
cadherin 2, type 1, N-cadherin (neuronal)
References
  • Jones M, et al. (2002) N-cadherin upregulation and function in response of smooth muscle cells to arterial injury. Arterioscler Thromb Vasc Biol. 22(12): 1972-7.
  • Nagi C, et al. (2005) N-cadherin expression in breast cancer: correlation with an aggressive histologic variant--invasive micropapillary carcinoma. Breast Cancer Res Treat. 94(3): 225-35.
  • Schrick C, et al. (2007) N-cadherin regulates cytoskeletally associated IQGAP1/ERK signaling and memory formation. Neuron. 55(5): 786-98.
  • Li K, et al. (2010) Downregulation of N-cadherin expression inhibits invasiveness, arrests cell cycle and induces cell apoptosis in esophageal squamous cell carcinoma. Cancer Invest. 28(5): 479-86.
  • N Cadherin cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    N Cadherin cDNA ORF Clone in Cloning Vector, Rat RG80275-G
    N Cadherin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80275-ACGLN
    N Cadherin qPCR Primer Pairs, Rat RP300256

    N Cadherin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    N Cadherin cDNA ORF Clone in Cloning Vector, Mouse MG50752-G
    N Cadherin cDNA ORF Clone, Mouse, untagged MG50752-UT
    N Cadherin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50752-ACG
    N Cadherin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50752-ACGLN
    N Cadherin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50752-ACR
    N Cadherin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50752-CF
    N Cadherin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50752-NF
    N Cadherin cDNA ORF Clone, Mouse, C-His tag MG50752-CH
    N Cadherin cDNA ORF Clone, Mouse, N-His tag MG50752-NH
    N Cadherin cDNA ORF Clone, Mouse, C-HA tag MG50752-CY
    N Cadherin cDNA ORF Clone, Mouse, N-HA tag MG50752-NY
    N Cadherin cDNA ORF Clone, Mouse, C-Myc tag MG50752-CM
    N Cadherin cDNA ORF Clone, Mouse, N-Myc tag MG50752-NM
    N Cadherin qPCR Primer Pairs, Mouse MP200727

    N Cadherin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    N Cadherin cDNA ORF Clone in Cloning Vector, Human HG11039-G
    N Cadherin cDNA ORF Clone, Human, untagged HG11039-G-N
    N Cadherin cDNA ORF Clone, Human, untagged HG11039-UT
    N Cadherin cDNA ORF Clone, Human, C-GFPSpark® tag HG11039-ACG
    N Cadherin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11039-ACGLN
    N Cadherin cDNA ORF Clone, Human, C-OFPSpark® tag HG11039-ACR
    N Cadherin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11039-CF
    N Cadherin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11039-G-F
    N Cadherin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11039-NF
    N Cadherin cDNA ORF Clone, Human, C-His tag HG11039-CH
    N Cadherin cDNA ORF Clone, Human, N-His tag HG11039-NH
    N Cadherin cDNA ORF Clone, Human, C-HA tag HG11039-CY
    N Cadherin cDNA ORF Clone, Human, N-HA tag HG11039-NY
    N Cadherin cDNA ORF Clone, Human, C-Myc tag HG11039-CM
    N Cadherin cDNA ORF Clone, Human, N-Myc tag HG11039-NM
    N Cadherin qPCR Primer Pairs, Human HP100018
    info info
    添加购物车成功! 添加购物车失败!