M-Cadherin cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG80281-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All M-Cadherin Reagents
CRO Services
Product recommended

All M-Cadherin Reagents
M-Cadherin cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2355 bp
Description
Full length Clone DNA of Rat cadherin 15 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

M-Cadherin Background Information

Cadherin-15, also known as CDH15, is a member of the cadherin superfamily. Cadherins consist of an extracellular domain containing 5 cadherin domains, a transmembrane region, and a conserved cytoplasmic domain. Cadherins are calcium dependent cell adhesion proteins. They preferentially interact with themselves in a homophilic manner in connecting cells; cadherins may thus contribute to the sorting of heterogeneous cell types. Cadherin-15 contains 5 cadherin domains. It is expressed in some normal epithelial tissues and in some carcinoma cell lines. Defects in CDH3 are the cause of ectodermal dysplasia with ectrodactyly and macular dystrophy (EEM), also known as EEM syndrome, Albrectsen-Svendsen syndrome or Ohdo-Hirayama-Terawaki syndrome. Ectodermal dysplasia defines a heterogeneous group of disorders due to abnormal development of two or more ectodermal structures. EEM is an autosomal recessive condition characterized by features of ectodermal dysplasia such as sparse eyebrows and scalp hair, and selective tooth agenesis associated with macular dystrophy and ectrodactyly.

Full Name
cadherin 15, type 1, M-cadherin (myotubule)
References
  • Shibata T, et al. (1997) Identification of human cadherin-14, a novel neurally specific type II cadherin, by protein interaction cloning. J Biol Chem. 272(8):5236-40.
  • Bornemann A, et al. (1994) Immunocytochemistry of M-cadherin in mature and regenerating rat muscle. Anat Rec. 239(2):119-25.
  • Donalies M, et al. (1991) Expression of M-cadherin, a member of the cadherin multigene family, correlates with differentiation of skeletal muscle cells. Proc Natl Acad Sci. 88(18):8024-8.
  • info info
    添加购物车成功! 添加购物车失败!