Quick Order

Rat CDH13 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Rat CDH13 cDNA Clone Product Information
NCBI RefSeq:NM_138889.2
RefSeq ORF Size:2145bp
cDNA Description:Full length Clone DNA of Rattus norvegicus cadherin 13.
Gene Synonym:Cdht, Tcad, MGC93172, T-cadherin, Cdh13
Species:Rat
Vector:pCMV3-untagged
Plasmid:pCMV3-ratCDH13
Restriction Site:HindIII + XbaI (6.1kb + 2.15kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 249T/C, 1386C/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Rat CDH13 Gene Plasmid Map
Rat CDH13 natural ORF mammalian expression plasmid
Product nameProduct name
Background

CDH13, also known as cadherin-13 and H Cadherin, is a member of the cadherin superfamily. CDH13 acts as a negative regulator of axon growth during neural differentiation. It also protects vascular endothelial cells from apoptosis due to oxidative stress, and is associated with resistance to atherosclerosis. CDH13 is localized to the surface of the cell membrane and is anchored by a GPI moiety, rather than by a transmembrane domain. CDH13 gene is hypermethylated in many types of cancer.

References
  • Hart AB. et al., 2012, PLoS One. 7 (8): e42646.
  • Xu J. et al., 2012, BMC Cancer. 12: 243.
  • Jo J. et al., 2012, Obesity (Silver Spring). 20 (8): 1683-7.
  • Size / Price
    Catalog: RG80280-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"