Quick Order

Text Size:AAA

Rat Cadherin-12/CDH12 Gene ORF cDNA clone expression plasmid, N-Flag tag

DatasheetReviewsRelated ProductsProtocols
Rat CDH12 cDNA Clone Product Information
NCBI RefSeq:XM_229369.5
RefSeq ORF Size:2385bp
cDNA Description:Full length Clone DNA of Rattus norvegicus cadherin 12 with N terminal Flag tag.
Gene Synonym:RGD1566350, Cdh12
Species:Rat
Vector:pCMV3-SP-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Classic Cadherins represent a family of calcium-dependent homophilic cell-cell adhesion molecules. They confer strong adhesiveness to animal cells when they are anchored to the actin cytoskeleton via their cytoplasmic binding partners, catenins. The cadherin/catenin adhesion system plays key roles in the morphogenesis and function of the vertebrate and invertebrate nervous systems. Furthermore, this system is involved in synaptic plasticity. Recent studies on the role of individual cadherin subtypes at synapses indicate that individual cadherin subtypes play their own unique role to regulate synaptic activities. Type II (atypical) cadherins are defined based on their lack of an HAV cell adhesion recognition sequence specific to type I cadherins. It has been observed that cells containing a specific cadherin subtype tend to cluster together to the exclusion of other types, both in cell culture and during development. Cadherin-12 also known as CDH12, is a type II classical cadherin from the cadherin superfamily of integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Cadherin-12 appears to be expressed specifically in the brain and its temporal pattern of expression would be consistent with a role during a critical period of neuronal development, perhaps specifically during synaptogenesis.

References
  • Tanihara H, et al. (1994) Cloning of five human cadherins clarifies characteristic features of cadherin extracellular domain and provides further evidence for two structurally different types of cadherin. Cell Adhes Commun. 2(1): 15-26.
  • Suzuki SC, et al. (2008) Cadherins in neuronal morphogenesis and function. Dev Growth Differ. 50 Suppl 1: S119-30.
  • Size / Price
    Catalog: RG80279-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"