CDC6 cDNA ORF Clone, Rat, N-His tag

Cat: RG80571-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CDC6 Reagents
CRO Services
Product recommended

All CDC6 Reagents
CDC6 cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1686 bp
Description
Full length Clone DNA of Rat cell division cycle 6 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CDC6 Background Information
Full Name
cell division cycle 6

CDC6 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CDC6 cDNA ORF Clone in Cloning Vector, Rat RG80571-U
CDC6 cDNA ORF Clone, Rat, untagged RG80571-UT
CDC6 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80571-ACG
CDC6 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80571-ACGLN
CDC6 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80571-ANG
CDC6 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80571-ACR
CDC6 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80571-ANR
CDC6 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80571-CF
CDC6 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80571-NF
CDC6 cDNA ORF Clone, Rat, C-His tag RG80571-CH
CDC6 cDNA ORF Clone, Rat, C-HA tag RG80571-CY
CDC6 cDNA ORF Clone, Rat, N-HA tag RG80571-NY
CDC6 cDNA ORF Clone, Rat, C-Myc tag RG80571-CM
CDC6 cDNA ORF Clone, Rat, N-Myc tag RG80571-NM
CDC6 qPCR Primer Pairs, Rat RP300535

CDC6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CDC6 cDNA ORF Clone in Cloning Vector, Human HG17177-U
CDC6 cDNA ORF Clone, Human, untagged HG17177-UT
CDC6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17177-ACGLN
CDC6 cDNA ORF Clone, Human, C-GFPSpark® tag HG17177-ACG
CDC6 cDNA ORF Clone, Human, N-GFPSpark® tag HG17177-ANG
CDC6 cDNA ORF Clone, Human, C-OFPSpark® tag HG17177-ACR
CDC6 cDNA ORF Clone, Human, N-OFPSpark® tag HG17177-ANR
CDC6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17177-CF
CDC6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17177-NF
CDC6 cDNA ORF Clone, Human, C-His tag HG17177-CH
CDC6 cDNA ORF Clone, Human, N-His tag HG17177-NH
CDC6 cDNA ORF Clone, Human, C-HA tag HG17177-CY
CDC6 cDNA ORF Clone, Human, N-HA tag HG17177-NY
CDC6 cDNA ORF Clone, Human, C-Myc tag HG17177-CM
CDC6 cDNA ORF Clone, Human, N-Myc tag HG17177-NM
info info
添加购物车成功! 添加购物车失败!