Quick Order

Rat CD96/TACTILE Gene ORF cDNA clone expression plasmid, N-His tag

    DatasheetReviewsRelated ProductsProtocols
    Rat CD96 cDNA Clone Product Information
    NCBI RefSeq:NM_001025032.1
    RefSeq ORF Size:1812bp
    cDNA Description:Full length Clone DNA of Rattus norvegicus CD96 molecule with N terminal His tag.
    Gene Synonym:Cd96
    Species:Rat
    Vector:pCMV3-SP-N-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CD96 qPCR primers for gene expression analysis, RP300308 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    Background

    The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. The CD155 ligand CD96 is a member of the Ig superfamily. It's a immunoglobulin-like protein tentatively allocated to the repertoire of human NK receptors. NK cells recognize poliovirus receptor (PVR), a nectins and nectin-like protein family member serve to mediate cell-cell adhesion, cell migration, with the presence of an additional receptor, CD96. CD96 promotes NK cell adhesion to target cells expressing PVR, stimulates cytotoxicity of activated NK cells, and mediates acquisition of PVR from target cells. The effect the cells with mutated CD96 protein lost adhesion and growth activities indicates that CD96 mutations may cause a form of the C syndrome by interfering with cell adhesion and growth.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12
  • Anja Fuchs, et al. (2004) Cutting Edge: CD96 (Tactile) Promotes NK Cell-Target Cell Adhesion by Interacting with the Poliovirus Receptor (CD155). The Journal of Immunology.172 (7): 3994-8.
  • Seth S, et al.(2007) The murine pan T cell marker CD96 is an adhesion receptor for CD155 and nectin-1. Biochemical and Biophysical Research Communications. 364 (4): 959-65.
  • Size / Price
    Catalog: RG80338-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"