Text Size:AAA

Rat CD95/APO-1/TNFRSF6 Gene ORF cDNA clone expression plasmid, N-His tag

    DatasheetReviewsRelated ProductsProtocols
    Rat FAS cDNA Clone Product Information
    NCBI RefSeq:NM_139194.2
    RefSeq ORF Size:975bp
    cDNA Description:Full length Clone DNA of Rattus norvegicus Fas (TNF receptor superfamily, member 6) with N terminal His tag.
    Gene Synonym:Tnfrsf6, Fas
    Species:Rat
    Vector:pCMV3-SP-N-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with FAS qPCR primers for gene expression analysis, RP300042 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    Background

    CD95 (APO-1/Fas) is an important inducer of the extrinsic apoptosis signaling pathway and therapy induced apoptosis of many tumor cells has been linked to the activity of CD95. is a prototype death receptor characterized by the presence of an 80 amino acid death domain in its cytoplasmic tail. This domain is essential for the recruitment of a number of signaling components upon activation by either agonistic anti-CD95 antibodies or cognate CD95 ligand that initiate apoptosis. The complex of proteins that forms upon triggering of CD95 is called the death-inducting signaling complex (DISC). The DISC consists of an adaptor protein and initiator caspases and is essential for induction of apoptosis. CD95 is also crucial for the negative selection of B cells within the germinal center (GC). Impairment of CD95-mediated apoptosis results in defective affinity maturation and the persistence of autoreactive B-cell clones. Changes in the expression of CD95 and/or its ligand CD95L are frequently found in human cancer. The downregulation or mutation of CD95 has been proposed as a mechanism by which cancer cells avoid destruction by the immune system through reduced apoptosis sensitivity. Thus, CD95 has therefore been viewed as a tumor suppressor. CD95 has been reported to be involved in the activation of NF-kappaB, MAPK3/ERK1, MAPK8/JNK, and the alternate pathways for CTL-mediated cytotoxicity. Accordingly, this protein is implicated in the pathogenesis of various malignancies and diseases of the immune system. The CD95/CD95L system was implicated in the etiology of inflammatory bowel disease (IBD) based, primarily, on the finding that CD95 is highly expressed in the intestinal epithelial cells and that epithelial apoptosis is increased in IBD.

    References
  • Mschen M, et al. (2002) The origin of CD95-gene mutations in B-cell lymphoma. Trends Immunol. 23(2): 75-80.
  • Peter ME, et al. (2003) The CD95(APO-1/Fas) DISC and beyond. Cell Death Differ. 10(1): 26-35.
  • Peter ME, et al. (2005) Does CD95 have tumor promoting activities Biochim Biophys Acta. 1755(1): 25-36.
  • Chen L, et al. (2010) Cell death in the colonic epithelium during inflammatory bowel diseases: CD95/Fas and beyond. Inflamm Bowel Dis. 16(6): 1071-6.
  • Size / Price
    Catalog: RG80043-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"