CD93 cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG80207-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD93 Reagents
CRO Services
Product recommended

All CD93 Reagents
CD93 cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1932 bp
Description
Full length Clone DNA of Rat CD93 molecule with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD93 Background Information

CD93 or C1q receptor 1 (C1qR) is an about 120 kDa O-sialoglycoprotein that within the hematopoietic system is selectively expressed on cells of the myeloid lineage. CD93/C1qR is a highly glycosylated transmembrane protein expressed on monocytes, neutrophils, endothelial cells, and stem cells. CD93 was originally identified as a myeloid cell-surface marker and subsequently associated with an ability to modulate phagocytosis of suboptimally opsonized immunoglobulin G and complement particles in vitro. CD93/C1qR, a receptor expressed during early B-cell development, is reinduced during plasma-cell differentiation. High CD93/CD138 expression was restricted to antibody-secreting cells both in T-dependent and T-independent responses as naive, memory, and germinal-center B cells remained CD93-negative. CD93 was expressed on (pre)plasmablasts/plasma cells, including long-lived plasma cells that showed decreased cell cycle activity, high levels of isotype-switched Ig secretion, and modification of the transcriptional network. CD93 is important for the maintenance of plasma cells in bone marrow niches.

Full Name
CD93 molecule
References
  • Bohlson SS, et al. (2005) CD93 is rapidly shed from the surface of human myeloid cells and the soluble form is detected in human plasma. J Immunol. 175(2): 1239-47.
  • Norsworthy PJ, et al. (2004) Murine CD93 (C1qRp) contributes to the removal of apoptotic cells in vivo but is not required for C1q-mediated enhancement of phagocytosis. J Immunol. 172(6): 3406-14.
  • Chevrier S, et al. (2009) CD93 is required for maintenance of antibody secretion and persistence of plasma cells in the bone marrow niche. Proc Natl Acad Sci U S A. 106(10): 3895-900.
  • CD93 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD93 cDNA ORF Clone in Cloning Vector, Rat RG80207-G
    CD93 cDNA ORF Clone, Rat, untagged RG80207-UT
    CD93 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80207-ACG
    CD93 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80207-ACGLN
    CD93 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80207-ACR
    CD93 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80207-CF
    CD93 cDNA ORF Clone, Rat, C-His tag RG80207-CH
    CD93 cDNA ORF Clone, Rat, N-His tag RG80207-NH
    CD93 cDNA ORF Clone, Rat, C-HA tag RG80207-CY
    CD93 cDNA ORF Clone, Rat, N-HA tag RG80207-NY
    CD93 cDNA ORF Clone, Rat, C-Myc tag RG80207-CM
    CD93 cDNA ORF Clone, Rat, N-Myc tag RG80207-NM
    CD93 qPCR Primer Pairs, Rat RP300199

    CD93 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD93 cDNA ORF Clone in Cloning Vector, Mouse MG50759-G
    CD93 cDNA ORF Clone, Mouse, untagged MG50759-UT
    CD93 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50759-ACGLN
    CD93 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50759-ACG
    CD93 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50759-ACR
    CD93 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50759-CF
    CD93 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50759-NF
    CD93 cDNA ORF Clone, Mouse, C-His tag MG50759-CH
    CD93 cDNA ORF Clone, Mouse, N-His tag MG50759-NH
    CD93 cDNA ORF Clone, Mouse, C-HA tag MG50759-CY
    CD93 cDNA ORF Clone, Mouse, N-HA tag MG50759-NY
    CD93 cDNA ORF Clone, Mouse, C-Myc tag MG50759-CM
    CD93 cDNA ORF Clone, Mouse, N-Myc tag MG50759-NM
    CD93 qPCR Primer Pairs, Mouse MP200733
    info info
    添加购物车成功! 添加购物车失败!