CD9 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80778-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CD9 Reagents
CRO Services
Product recommended

All CD9 Reagents
CD9 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
681 bp
Description
Full length Clone DNA of Rat CD9 molecule with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD9 Background Information

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD9 is a member of the transmembrane 4 superfamily, which is also known as the tetraspanin family. CD9 is a cell surface glycoprotein with 4 hydrophobic domains that is described to complex with integrins and other transmembrane 4 superfamily members. It is found expressed on the surface of the exosomes. The protein takes part in cellular signal transduction events and thus play a role in the regulation of cell development and activation, growth and motility. Besides, CD9 seems to be a key role in the egg-sperm fusion during the mammalian fertilization processes. CD9 is found on the membrane of the oocytes and also appears to intervene in maintaining the normal shape of oocyte microvilli.

Full Name
CD9 molecule
References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12
  • Franois Le Naour, et al. (2000) Severely Reduced Female Fertility in CD9-Deficient Mice. Science. 287(5451): 319-21.
  • CD9 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD9 cDNA ORF Clone in Cloning Vector, Rat RG80778-U
    CD9 cDNA ORF Clone, Rat, untagged RG80778-UT
    CD9 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80778-ACG
    CD9 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80778-ACGLN
    CD9 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80778-ACR
    CD9 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80778-CF
    CD9 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80778-NF
    CD9 cDNA ORF Clone, Rat, C-His tag RG80778-CH
    CD9 cDNA ORF Clone, Rat, N-His tag RG80778-NH
    CD9 cDNA ORF Clone, Rat, C-HA tag RG80778-CY
    CD9 cDNA ORF Clone, Rat, N-HA tag RG80778-NY
    CD9 cDNA ORF Clone, Rat, C-Myc tag RG80778-CM
    CD9 qPCR Primer Pairs, Rat RP300742

    CD9 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD9 cDNA ORF Clone in Cloning Vector, Mouse MG50395-M
    CD9 cDNA ORF Clone, Mouse, untagged MG50395-UT
    CD9 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50395-ACGLN
    CD9 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50395-ACG
    CD9 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50395-ACR
    CD9 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50395-CF
    CD9 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50395-NF
    CD9 cDNA ORF Clone, Mouse, C-His tag MG50395-CH
    CD9 cDNA ORF Clone, Mouse, N-His tag MG50395-NH
    CD9 cDNA ORF Clone, Mouse, C-HA tag MG50395-CY
    CD9 cDNA ORF Clone, Mouse, N-HA tag MG50395-NY
    CD9 cDNA ORF Clone, Mouse, C-Myc tag MG50395-CM
    CD9 cDNA ORF Clone, Mouse, N-Myc tag MG50395-NM
    CD9 qPCR Primer Pairs, Mouse MP200413

    CD9 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD9 cDNA ORF Clone in Cloning Vector, Human HG11029-M
    CD9 cDNA ORF Clone, Human, untagged HG11029-UT
    CD9 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11029-ACGLN
    CD9 cDNA ORF Clone, Human, C-GFPSpark® tag HG11029-ACG
    CD9 cDNA ORF Clone, Human, C-OFPSpark® tag HG11029-ACR
    CD9 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11029-CF
    CD9 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11029-NF
    CD9 cDNA ORF Clone, Human, C-His tag HG11029-CH
    CD9 cDNA ORF Clone, Human, N-His tag HG11029-NH
    CD9 cDNA ORF Clone, Human, C-HA tag HG11029-CY
    CD9 cDNA ORF Clone, Human, N-HA tag HG11029-NY
    CD9 cDNA ORF Clone, Human, C-Myc tag HG11029-CM
    CD9 cDNA ORF Clone, Human, N-Myc tag HG11029-NM
    CD9 qPCR Primer Pairs, Human HP100019
    info info
    添加购物车成功! 添加购物车失败!