Quick Order

Rat CD81/TAPA1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Rat CD81 cDNA Clone Product Information
NCBI RefSeq:BC060583.1
RefSeq ORF Size:711bp
cDNA Description:Full length Clone DNA of Rattus norvegicus Cd81 molecule.
Gene Synonym:Tapa1, Cd81
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

CD81, also known as TAPA-1, belongs to the transmembrane 4 superfamily, also known as the tetraspanin family. Members of this family mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility.CD81 is a widely expressed cell-surface protein involved in an astonishing variety of biologic responses. It is related to adhesion, morphology, activation, proliferation, and differentiation of B, T, and other cells. On B cells CD81 is part of a complex with CD21, CD19, and Leu13. This complex reduces the threshold for B cell activation via the B cell receptor by bridging Ag specific recognition and CD21-mediated complement recognition.

References
  • Petracca R. et al., 2000, J Virol. 74 (10): 4824-30.
  • Bartosch B. et al., 2003, The Journal of Biological Chemistry. 278 (43): 41624-30.
  • Clark KL. et al., 2001, Journal of Immunology. 167 (9): 5115-21.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"