Quick Order

Rat CD81/TAPA1 Gene ORF cDNA clone expression plasmid, C-His tag

    DatasheetReviewsRelated ProductsProtocols
    Rat CD81 cDNA Clone Product Information
    NCBI RefSeq:BC060583.1
    RefSeq ORF Size:711bp
    cDNA Description:Full length Clone DNA of Rattus norvegicus Cd81 molecule with C terminal His tag.
    Gene Synonym:Tapa1, Cd81
    Species:Rat
    Vector:pCMV3-C-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CD81 qPCR primers for gene expression analysis, RP300301 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    Background

    CD81, also known as TAPA-1, belongs to the transmembrane 4 superfamily, also known as the tetraspanin family. Members of this family mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility.CD81 is a widely expressed cell-surface protein involved in an astonishing variety of biologic responses. It is related to adhesion, morphology, activation, proliferation, and differentiation of B, T, and other cells. On B cells CD81 is part of a complex with CD21, CD19, and Leu13. This complex reduces the threshold for B cell activation via the B cell receptor by bridging Ag specific recognition and CD21-mediated complement recognition.

    References
  • Petracca R. et al., 2000, J Virol. 74 (10): 4824-30.
  • Bartosch B. et al., 2003, The Journal of Biological Chemistry. 278 (43): 41624-30.
  • Clark KL. et al., 2001, Journal of Immunology. 167 (9): 5115-21.
  • Size / Price
    Catalog: RG80331-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"