CD68 cDNA ORF Clone, Rat, untagged

Cat: RG80307-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD68 Reagents
CRO Services
Product recommended

All CD68 Reagents
CD68 cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
993 bp
Description
Full length Clone DNA of Rat Cd68 molecule.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD68 Background Information

Macrosialin, also known as CD68 and Gp110, is a single-pass type I  membrane protein which belongs to the LAMP family. CD68 is highly expressed by blood monocytes and tissue macrophages. It is also expressed in lymphocytes, fibroblasts and endothelial cells. CD68 is expressed in many tumor cell lines which could allow them to attach to selectins on vascular endothelium, facilitating their dissemination to secondary sites. CD68 plays a role in phagocytic activities of tissue macrophages, both in intracellular lysosomal metabolism and extracellular cell-cell and cell-pathogen interactions. It is a commonly used marker for macrophages. However, a number of studies have shown that CD68 antibodies react with other hematopoietic and non-hematopoietic cell types, suggesting that CD68 may not be a macrophage-specific antigen. CD68 binds to tissue- and organ-specific lectins or selectins, allowing homing of macrophage subsets to particular sites. Rapid recirculation of CD68 from endosomes and lysosomes to the plasma membrane may allow macrophages to crawl over selectin-bearing substrates or other cells.

Full Name
CD68 molecule
References
  • Strobl H. et al., 1995, Br J Haematol. 90 (4): 774-82.
  • Ogawa Y. et al., 1995, Pathol Int. 45 (9): 698-701.
  • Sadovnikova E. et al., 2002,Leukemia. 16 (10): 2019-26.
  • Gottfried E. et al., 2008, Scand J Immunol. 67 (5): 453-63.
  • Strojnik T. et al., 2009, Anticancer Res. 29 (8): 3269-79.
  • CD68 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD68 cDNA ORF Clone in Cloning Vector, Rat RG80307-G
    CD68 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80307-ACGLN
    CD68 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80307-ACG
    CD68 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80307-ACR
    CD68 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80307-CF
    CD68 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80307-NF
    CD68 cDNA ORF Clone, Rat, C-His tag RG80307-CH
    CD68 cDNA ORF Clone, Rat, N-His tag RG80307-NH
    CD68 cDNA ORF Clone, Rat, C-HA tag RG80307-CY
    CD68 cDNA ORF Clone, Rat, N-HA tag RG80307-NY
    CD68 cDNA ORF Clone, Rat, C-Myc tag RG80307-CM
    CD68 cDNA ORF Clone, Rat, N-Myc tag RG80307-NM
    CD68 qPCR Primer Pairs, Rat RP300283

    CD68 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD68 cDNA ORF Clone in Cloning Vector, Mouse MG50730-G
    CD68 cDNA ORF Clone, Mouse, untagged MG50730-UT
    CD68 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50730-ACGLN
    CD68 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50730-ACG
    CD68 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50730-ACR
    CD68 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50730-CF
    CD68 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50730-NF
    CD68 cDNA ORF Clone, Mouse, C-His tag MG50730-CH
    CD68 cDNA ORF Clone, Mouse, N-His tag MG50730-NH
    CD68 cDNA ORF Clone, Mouse, C-HA tag MG50730-CY
    CD68 cDNA ORF Clone, Mouse, N-HA tag MG50730-NY
    CD68 cDNA ORF Clone, Mouse, C-Myc tag MG50730-CM
    CD68 cDNA ORF Clone, Mouse, N-Myc tag MG50730-NM
    CD68 qPCR Primer Pairs, Mouse MP200705

    CD68 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD68 cDNA ORF Clone in Cloning Vector, Human HG11192-M
    CD68 cDNA ORF Clone, Human, untagged HG11192-UT
    CD68 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11192-ACGLN
    CD68 cDNA ORF Clone, Human, C-GFPSpark® tag HG11192-ACG
    CD68 cDNA ORF Clone, Human, C-OFPSpark® tag HG11192-ACR
    CD68 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11192-CF
    CD68 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11192-NF
    CD68 cDNA ORF Clone, Human, C-His tag HG11192-CH
    CD68 cDNA ORF Clone, Human, N-His tag HG11192-NH
    CD68 cDNA ORF Clone, Human, C-HA tag HG11192-CY
    CD68 cDNA ORF Clone, Human, N-HA tag HG11192-NY
    CD68 cDNA ORF Clone, Human, C-Myc tag HG11192-CM
    CD68 cDNA ORF Clone, Human, N-Myc tag HG11192-NM
    CD68 qPCR Primer Pairs, Human HP101097
    info info
    添加购物车成功! 添加购物车失败!