Quick Order

Text Size:AAA

Rat CD59 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Rat CD59 cDNA Clone Product Information
NCBI RefSeq:NM_012925.1
RefSeq ORF Size:381bp
cDNA Description:Full length Clone DNA of Rattus norvegicus CD59 molecule, complement regulatory protein with N terminal His tag.
Gene Synonym:Cd59a, Cd59b, MACIF, MACIP, MAC-IP, Cd59
Species:Rat
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

CD59 glycoprotein, also known as 20 kDa homologous restriction factor, HRF20, MAC-inhibitory protein, Membrane attack complex inhibition factor, Membrane inhibitor of reactive lysis, MIC11, MIRL and CD59, is a cell membrane protein which contains one UPAR/Ly6 domain. CD59 is a small, highly glycosylated, GPI-linked protein, with a wide expression profile. The soluble form of CD59 from urine retains its specific complement binding activity, but exhibits greatly reduced ability to inhibit MAC assembly on cell membranes. CD59 is a potent inhibitor of the complement membrane attack complex (MAC) action. CD59 was first identified as a regulator of the terminal pathway of complement. It acts by binding to the C8 and/or C9 complements of the assembling MAC, thereby preventing incorporation of the multiple copies of C9 required for complete formation of the osmolytic pore. This inhibitor appears to be species-specific. CD59 is involved in signal transduction for T-cell activation complexed to a protein tyrosine kinase. Defects in CD59 are the cause of CD59 deficiency (CD59D).

References
  • Fletcher CM. et al., 1994, Structure. 2: 185-99.
  • Rudd PM. et al., 1997, J Biol Chem. 272: 7229-44.
  • Kimberley FC. et al., 2007, Mol Immunol. 44 (1-3): 73-81.
  • Gong Y. et al., 2007, Sci China C Life Sci. 50 (6): 773-9.
  • Picariello G. et al., 2008, Proteomics 8: 3833-47.
  • Heibeck TH. et al., 2009, J Proteome Res. 8: 3852-61.
  • Size / Price
    Catalog: RG80299-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"