CD31 cDNA ORF Clone, Rat, C-Myc tag

Cat: RG80091-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
Leave us a message
All CD31 Reagents
CRO Services
Product recommended
All CD31 Reagents
CD31 cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
NM_031591.1
RefSeq ORF Size
2037 bp
Description
Full length Clone DNA of Rat platelet/endothelial cell adhesion molecule 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD31 Background Information

The Cluster of Differentiation 31 (CD31) adhesion molecule, also known as platelet-endothelial cell adhesion molecule-1 (PECAM-1), is the only known member of the CAM family on platelets. CD31 protein is a 130-kDa transmembrane glycoprotein expressed by endothelial cells, platelets, monocytes, neutrophils, and certain T cell subsets. CD31 protein is also expressed in certain tumors, including epithelioid hemangioendothelioma, other vascular tumors, and histiocytic malignancies. CD31 plays a key role in removing aged neutrophils and tissue regeneration. CD31 protein mediates the homotypic or heterotypic cell adhesion by binding to itself or the leukocyte integrin αvβ3, and thus plays a role in neutrophil recruitment in inflammatory responses, transendothelial migration of leukocytes, as well as in cardiovascular development.

Full Name
platelet/endothelial cell adhesion molecule 1
Research Areas
References
  • Deaglio S, et al. (2000) CD38/CD31, a receptor/ligand system ruling adhesion and signaling in human leukocytes. Chem Immunol. 75: 99-120.
  • Kohler S, et al. (2009) Life after the thymus: CD31+ and CD31- human naive CD4+ T-cell subsets. Blood. 113(4): 769-74.

    • CD31 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CD31 cDNA ORF Clone in Cloning Vector, Rhesus CG90024-G
    CD31 cDNA ORF Clone, Rhesus, untagged CG90024-UT
    CD31 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90024-ACG
    CD31 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90024-ACGLN
    CD31 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90024-ACR
    CD31 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90024-CF
    CD31 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90024-NF
    CD31 cDNA ORF Clone, Rhesus, C-His tag CG90024-CH
    CD31 cDNA ORF Clone, Rhesus, N-His tag CG90024-NH
    CD31 cDNA ORF Clone, Rhesus, C-HA tag CG90024-CY
    CD31 cDNA ORF Clone, Rhesus, N-HA tag CG90024-NY
    CD31 cDNA ORF Clone, Rhesus, C-Myc tag CG90024-CM
    CD31 cDNA ORF Clone, Rhesus, N-Myc tag CG90024-NM

    CD31 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD31 cDNA ORF Clone in Cloning Vector, Rat RG80091-G
    CD31 cDNA ORF Clone, Rat, untagged RG80091-UT
    CD31 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80091-ACGLN
    CD31 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80091-ACG
    CD31 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80091-ACR
    CD31 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80091-CF
    CD31 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80091-NF
    CD31 cDNA ORF Clone, Rat, C-His tag RG80091-CH
    CD31 cDNA ORF Clone, Rat, N-His tag RG80091-NH
    CD31 cDNA ORF Clone, Rat, C-HA tag RG80091-CY
    CD31 cDNA ORF Clone, Rat, N-HA tag RG80091-NY
    CD31 cDNA ORF Clone, Rat, N-Myc tag RG80091-NM
    CD31 qPCR Primer Pairs, Rat RP300087

    CD31 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD31 cDNA ORF Clone in Cloning Vector, Mouse MG50408-M
    CD31 cDNA ORF Clone, Mouse, untagged MG50408-UT
    CD31 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50408-ACGLN
    CD31 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50408-ACG
    CD31 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50408-ACR
    CD31 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50408-CF
    CD31 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50408-NF
    CD31 cDNA ORF Clone, Mouse, C-His tag MG50408-CH
    CD31 cDNA ORF Clone, Mouse, N-His tag MG50408-NH
    CD31 cDNA ORF Clone, Mouse, C-HA tag MG50408-CY
    CD31 cDNA ORF Clone, Mouse, N-HA tag MG50408-NY
    CD31 cDNA ORF Clone, Mouse, C-Myc tag MG50408-CM
    CD31 cDNA ORF Clone, Mouse, N-Myc tag MG50408-NM
    CD31 qPCR Primer Pairs, Mouse MP200085

    CD31 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD31 cDNA ORF Clone in Cloning Vector, Human HG10148-M
    CD31 cDNA ORF Clone, Human, untagged HG10148-UT
    CD31 cDNA ORF Clone, Human, C-GFPSpark® tag HG10148-ACG
    CD31 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10148-ACGLN
    CD31 cDNA ORF Clone, Human, C-OFPSpark® tag HG10148-ACR
    CD31 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10148-CF
    CD31 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10148-NF
    CD31 cDNA ORF Clone, Human, C-His tag HG10148-CH
    CD31 cDNA ORF Clone, Human, N-His tag HG10148-NH
    CD31 cDNA ORF Clone, Human, C-HA tag HG10148-CY
    CD31 cDNA ORF Clone, Human, N-HA tag HG10148-NY
    CD31 cDNA ORF Clone, Human, C-Myc tag HG10148-CM
    CD31 cDNA ORF Clone, Human, N-Myc tag HG10148-NM
    CD31 qPCR Primer Pairs, Human HP100219
    info info
    添加购物车成功！ 添加购物车失败！