CLM-9 cDNA ORF Clone, Rat, untagged

Cat: RG80413-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CLM-9 Reagents
CRO Services
Product recommended

All CLM-9 Reagents
CLM-9 cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
849 bp
Description
Full length Clone DNA of Rat Cd300 molecule-like family member G.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CLM-9 Background Information

CLM-9, also known as TREM4, is a receptor which belongs to the TREM family. The TREM family of receptors regulates the activity of various cell types of the immune system including neutrophils, monocyte/macrophages, microglia, and dendritic cells. CLM-9 may mediate L-selectin-dependent lymphocyte rollings. It binds SELL in a calcium dependent manner. CLM-9 also binds lymphocyte which suggests that it functions in lymphocyte adhesion. The major CLM-9 transcript is expressed highly in human heart, skeletal muscle, and placenta. The mouse protein has been shown to be expressed in capillary endothelial cells. Human CLM-9 mediates the uptake of human IgA2 and mouse IgM.

Full Name
CD300 molecule-like family member g
References
  • Clark GJ, et al. (2009) The CD300 molecules regulate monocyte and dendritic cell functions. Immunobiology. 214(9-10):730-6.
  • Engel K, et al. (2012) Bacterial expression of mutant argininosuccinate lyase reveals imperfect correlation of in-vitro enzyme activity with clinical phenotype in argininosuccinic aciduria. J Inherit Metab Dis. 35(1):133-40.
  • Lamesch P, et al. (2007) hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes. Genomics. 89(3):307-15.
  • CLM-9 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CLM-9 cDNA ORF Clone in Cloning Vector, Rat RG80413-G
    CLM-9 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80413-ACGLN
    CLM-9 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80413-ACG
    CLM-9 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80413-ACR
    CLM-9 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80413-CF
    CLM-9 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80413-NF
    CLM-9 cDNA ORF Clone, Rat, C-His tag RG80413-CH
    CLM-9 cDNA ORF Clone, Rat, N-His tag RG80413-NH
    CLM-9 cDNA ORF Clone, Rat, C-HA tag RG80413-CY
    CLM-9 cDNA ORF Clone, Rat, N-HA tag RG80413-NY
    CLM-9 cDNA ORF Clone, Rat, C-Myc tag RG80413-CM
    CLM-9 cDNA ORF Clone, Rat, N-Myc tag RG80413-NM
    CLM-9 qPCR Primer Pairs, Rat RP300377

    CLM-9 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CLM-9 cDNA ORF Clone in Cloning Vector, Human HG13365-G
    CLM-9 cDNA ORF Clone, Human, untagged HG13365-UT
    CLM-9 cDNA ORF Clone, Human, C-GFPSpark® tag HG13365-ACG
    CLM-9 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13365-ACGLN
    CLM-9 cDNA ORF Clone, Human, C-OFPSpark® tag HG13365-ACR
    CLM-9 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13365-CF
    CLM-9 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13365-NF
    CLM-9 cDNA ORF Clone, Human, C-His tag HG13365-CH
    CLM-9 cDNA ORF Clone, Human, N-His tag HG13365-NH
    CLM-9 cDNA ORF Clone, Human, C-HA tag HG13365-CY
    CLM-9 cDNA ORF Clone, Human, N-HA tag HG13365-NY
    CLM-9 cDNA ORF Clone, Human, C-Myc tag HG13365-CM
    CLM-9 cDNA ORF Clone, Human, N-Myc tag HG13365-NM
    CLM-9 qPCR Primer Pairs, Human HP102070
    info info
    添加购物车成功! 添加购物车失败!