CD300E cDNA ORF Clone, Rat, C-HA tag

Cat: RG80411-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD300E Reagents
CRO Services
Product recommended

All CD300E Reagents
CD300E cDNA ORF Clone, Rat, C-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
615 bp
Description
Full length Clone DNA of Rat CD300e molecule with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD300E Background Information
Full Name
CD300e molecule

CD300E cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CD300E cDNA ORF Clone in Cloning Vector, Rat RG80411-G
CD300E cDNA ORF Clone, Rat, untagged RG80411-UT
CD300E cDNA ORF Clone, Rat, C-GFPSpark® tag RG80411-ACG
CD300E Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80411-ACGLN
CD300E cDNA ORF Clone, Rat, C-OFPSpark® tag RG80411-ACR
CD300E cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80411-CF
CD300E cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80411-NF
CD300E cDNA ORF Clone, Rat, C-His tag RG80411-CH
CD300E cDNA ORF Clone, Rat, N-His tag RG80411-NH
CD300E cDNA ORF Clone, Rat, N-HA tag RG80411-NY
CD300E cDNA ORF Clone, Rat, C-Myc tag RG80411-CM
CD300E cDNA ORF Clone, Rat, N-Myc tag RG80411-NM
CD300E qPCR Primer Pairs, Rat RP300375

CD300E cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CD300E cDNA ORF Clone in Cloning Vector, Mouse MG50983-G
CD300E cDNA ORF Clone, Mouse, untagged MG50983-UT
CD300E Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50983-ACGLN
CD300E cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50983-ACG
CD300E cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50983-ACR
CD300E cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50983-CF
CD300E cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50983-NF
CD300E cDNA ORF Clone, Mouse, C-His tag MG50983-CH
CD300E cDNA ORF Clone, Mouse, N-His tag MG50983-NH
CD300E cDNA ORF Clone, Mouse, C-HA tag MG50983-CY
CD300E cDNA ORF Clone, Mouse, N-HA tag MG50983-NY
CD300E cDNA ORF Clone, Mouse, C-Myc tag MG50983-CM
CD300E cDNA ORF Clone, Mouse, N-Myc tag MG50983-NM
CD300E qPCR Primer Pairs, Mouse MP200949

CD300E cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CD300E cDNA ORF Clone in Cloning Vector, Human HG15572-G
CD300E cDNA ORF Clone, Human, untagged HG15572-UT
CD300E cDNA ORF Clone, Human, C-GFPSpark® tag HG15572-ACG
CD300E Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15572-ACGLN
CD300E cDNA ORF Clone, Human, C-OFPSpark® tag HG15572-ACR
CD300E cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15572-CF
CD300E cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15572-NF
CD300E cDNA ORF Clone, Human, C-His tag HG15572-CH
CD300E cDNA ORF Clone, Human, N-His tag HG15572-NH
CD300E cDNA ORF Clone, Human, C-HA tag HG15572-CY
CD300E cDNA ORF Clone, Human, N-HA tag HG15572-NY
CD300E cDNA ORF Clone, Human, C-Myc tag HG15572-CM
CD300E cDNA ORF Clone, Human, N-Myc tag HG15572-NM
CD300E qPCR Primer Pairs, Human HP104192
info info
添加购物车成功! 添加购物车失败!