CD300A cDNA ORF Clone, Rat, untagged

Cat: RG80410-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CD300A Reagents
CRO Services
Product recommended

All CD300A Reagents
CD300A cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
933 bp
Description
Full length Clone DNA of Rat CD300A molecule.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD300A Background Information

CMRF35-like molecule 8, also known as CD300 antigen-like family member A, CMRF35-H9, Immunoglobulin superfamily member 12, Inhibitory receptor protein 60, NK inhibitory receptor, CD300a and CMRF35H, is a single-pass type I membrane protein which belongs to the CD300 family. The CD300 family of myeloid immunoglobulin receptors includes activating ( CD300b, CD300e ) and inhibitory members ( CD300a, CD300f ), as well as molecules presenting a negative charge within their transmembrane domain ( CD300c, CD300d ).  CD300A / IGSF12 is expressed not only by natural killer (NK) cells but also by T-cell subsets, B-cells, dendritic cells, mast cells, granulocytes and monocytes.It contains one Ig-like V-type ( immunoglobulin-like ) domain. CD300A / IGSF12 is an inhibitory receptor which may contribute to the down-regulation of cytolytic activity in natural killer (NK) cells, and to the down-regulation of mast cell degranulation. CD300c is a functional immune receptor able to deliver activating signals upon ligation in RBL-2H3 mast cells. CD300c signaling is partially mediated by a direct association with the immune receptor tyrosine-based activation motif-bearing adaptor FcεRγ. CD300a and CD300c play an important role in the cross-regulation of TNF-alpha and IFN-alpha secretion from plasmacytoid dendritic cells (pDCs).

Full Name
CD300a molecule
References
  • Bachelet,I. et al., 2005, J. Immunol. 175:7989-7995.
  • Bachelet,I. et al., 2008, J Immunol. 180 (9):6064-9.
  • Ju,X. et al., 2008, Blood. 112 (4):1184-94.
  • Martínez-Barriocanal,A. et al., 2010, J Biol Chem. 285 (53):41781-94.
  • Lankry,D. et al., 2010, J Immunol. 185 (5):2877-86.
  • CD300A cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD300A cDNA ORF Clone in Cloning Vector, Rat RG80410-G
    CD300A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80410-ACGLN
    CD300A cDNA ORF Clone, Rat, C-GFPSpark® tag RG80410-ACG
    CD300A cDNA ORF Clone, Rat, C-OFPSpark® tag RG80410-ACR
    CD300A cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80410-CF
    CD300A cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80410-NF
    CD300A cDNA ORF Clone, Rat, C-His tag RG80410-CH
    CD300A cDNA ORF Clone, Rat, N-His tag RG80410-NH
    CD300A cDNA ORF Clone, Rat, C-HA tag RG80410-CY
    CD300A cDNA ORF Clone, Rat, N-HA tag RG80410-NY
    CD300A cDNA ORF Clone, Rat, C-Myc tag RG80410-CM
    CD300A cDNA ORF Clone, Rat, N-Myc tag RG80410-NM
    CD300A qPCR Primer Pairs, Rat RP300374

    CD300A cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD300A cDNA ORF Clone in Cloning Vector, Mouse MG50675-M
    CD300A cDNA ORF Clone, Mouse, untagged MG50675-UT
    CD300A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50675-ACGLN
    CD300A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50675-ACG
    CD300A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50675-ACR
    CD300A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50675-CF
    CD300A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50675-NF
    CD300A cDNA ORF Clone, Mouse, C-His tag MG50675-CH
    CD300A cDNA ORF Clone, Mouse, N-His tag MG50675-NH
    CD300A cDNA ORF Clone, Mouse, C-HA tag MG50675-CY
    CD300A cDNA ORF Clone, Mouse, N-HA tag MG50675-NY
    CD300A cDNA ORF Clone, Mouse, C-Myc tag MG50675-CM
    CD300A cDNA ORF Clone, Mouse, N-Myc tag MG50675-NM
    CD300A qPCR Primer Pairs, Mouse MP200654

    CD300A cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD300A cDNA ORF Clone, Human, untagged HG12449-G-N
    CD300A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12449-ACGLN
    CD300A qPCR Primer Pairs, Human HP104789
    info info
    添加购物车成功! 添加购物车失败!