B7-H3 cDNA ORF Clone, Rat, C-His tag

Cat: RG80380-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All B7-H3 Reagents
CRO Services
Product recommended

All B7-H3 Reagents
B7-H3 cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
951 bp
Description
Full length Clone DNA of Rat Cd276 molecule with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

B7-H3 Background Information

B7-H3 is a member of the B7 family of immune regulatory ligands that is thought to attenuate peripheral immune responses through co-inhibition. It plays an important role in adaptive immune responses, and was shown to either promote or inhibit T-cell responses in various experimental systems. B7-H3 may play an important role in muscle-immune interactions, providing further evidence of the active role of muscle cells in local immunoregulatory processes. B7-H3 is a novel protein structurally related to the B7 family of ligands by the presence of a single set of immunoglobulin-V-like and immunoglobulin-C-like (VC) domains. Previous studies have correlated its overexpression with poor prognosis and decreased tumor-infiltrating lymphocytes in various carcinomas including uterine endometrioid carcinomas, and mounting evidence supports an immuno-inhibitory role in ovarian cancer prognosis. Recently, B7-H3 expression has been reported in several human cancers indicating an additional function of B7-H3 as a regulator of antitumor immunity.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: ICC Antibodies   Immune Checkpoint Detection: IP Antibodies   Immune Checkpoint Detection: FCM Antibodies   Immune Checkpoint Detection: WB Antibodies
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
CD276 molecule
References
  • Suh WK, et al. (2004) The immune regulatory protein B7-H3 promotes osteoblast differentiation and bone mineralization. Proc Natl Acad Sci U S A. 101(35): 12969-73.
  • Waschbisch A, et al. (2008) Human muscle cells express the costimulatory molecule B7-H3, which modulates muscle-immune interactions. Arthritis Rheum. 58(11): 3600-8.
  • Loos M, et al. (2010) B7-h3 and its role in antitumor immunity. Clin Dev Immunol. 2010: 683875.
  • Zang X, et al. (2010) Tumor associated endothelial expression of B7-H3 predicts survival in ovarian carcinomas. Mod Pathol. 23(8): 1104-12.
  • Sun J, et al. (2010) Clinical significance and regulation of the costimulatory molecule B7-H3 in human colorectal carcinoma. Cancer Immunol Immunother. 59(8): 1163-71.
  • B7-H3 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    B7-H3 cDNA ORF Clone in Cloning Vector, Rat RG80380-G
    B7-H3 cDNA ORF Clone, Rat, untagged RG80380-UT
    B7-H3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80380-ACGLN
    B7-H3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80380-ACG
    B7-H3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80380-ACR
    B7-H3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80380-CF
    B7-H3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80380-NF
    B7-H3 cDNA ORF Clone, Rat, N-His tag RG80380-NH
    B7-H3 cDNA ORF Clone, Rat, C-HA tag RG80380-CY
    B7-H3 cDNA ORF Clone, Rat, N-HA tag RG80380-NY
    B7-H3 cDNA ORF Clone, Rat, C-Myc tag RG80380-CM
    B7-H3 cDNA ORF Clone, Rat, N-Myc tag RG80380-NM
    B7-H3 qPCR Primer Pairs, Rat RP300347

    B7-H3 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    B7-H3 cDNA ORF Clone in Cloning Vector, Mouse MG50973-G
    B7-H3 cDNA ORF Clone, Mouse, untagged MG50973-UT
    B7-H3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50973-ACG
    B7-H3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50973-ACGLN
    B7-H3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50973-ACR
    B7-H3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50973-CF
    B7-H3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50973-NF
    B7-H3 cDNA ORF Clone, Mouse, C-His tag MG50973-CH
    B7-H3 cDNA ORF Clone, Mouse, N-His tag MG50973-NH
    B7-H3 cDNA ORF Clone, Mouse, C-HA tag MG50973-CY
    B7-H3 cDNA ORF Clone, Mouse, N-HA tag MG50973-NY
    B7-H3 cDNA ORF Clone, Mouse, C-Myc tag MG50973-CM
    B7-H3 cDNA ORF Clone, Mouse, N-Myc tag MG50973-NM
    B7-H3 qPCR Primer Pairs, Mouse MP200942

    B7-H3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    B7-H3 cDNA ORF Clone in Cloning Vector, Human HG11188-M
    B7-H3 cDNA ORF Clone, Human, untagged HG11188-UT
    B7-H3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11188-ACGLN
    B7-H3 cDNA ORF Clone, Human, C-GFPSpark® tag HG11188-ACG
    B7-H3 cDNA ORF Clone, Human, C-OFPSpark® tag HG11188-ACR
    B7-H3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11188-CF
    B7-H3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11188-NF
    B7-H3 cDNA ORF Clone, Human, C-His tag HG11188-CH
    B7-H3 cDNA ORF Clone, Human, N-His tag HG11188-NH
    B7-H3 cDNA ORF Clone, Human, C-HA tag HG11188-CY
    B7-H3 cDNA ORF Clone, Human, N-HA tag HG11188-NY
    B7-H3 cDNA ORF Clone, Human, C-Myc tag HG11188-CM
    B7-H3 cDNA ORF Clone, Human, N-Myc tag HG11188-NM
    B7-H3 qPCR Primer Pairs, Human HP100093
    info info
    添加购物车成功! 添加购物车失败!