Text Size:AAA

Rat B7-H3/CD276 Gene ORF cDNA clone expression plasmid, C-His tag

    DatasheetReviewsRelated ProductsProtocols
    Rat CD276 cDNA Clone Product Information
    NCBI RefSeq:NM_182824.2
    RefSeq ORF Size:951bp
    cDNA Description:Full length Clone DNA of Rat Cd276 molecule with C terminal His tag.
    Gene Synonym:B7h3, B7RP-2, Cd276
    Species:Rat
    Vector:pCMV3-C-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7( 5' TAATACGACTCACTATAGGG 3' )
    BGH( 5' TAGAAGGCACAGTCGAGG 3' )
    ( We provide with CD276 qPCR primers for gene expression analysis, RP300347 )
    Promoter:Enhanced CMV cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    Background

    B7-H3 is a member of the B7 family of immune regulatory ligands that is thought to attenuate peripheral immune responses through co-inhibition. It plays an important role in adaptive immune responses, and was shown to either promote or inhibit T-cell responses in various experimental systems. B7-H3 may play an important role in muscle-immune interactions, providing further evidence of the active role of muscle cells in local immunoregulatory processes. B7-H3 is a novel protein structurally related to the B7 family of ligands by the presence of a single set of immunoglobulin-V-like and immunoglobulin-C-like (VC) domains. Previous studies have correlated its overexpression with poor prognosis and decreased tumor-infiltrating lymphocytes in various carcinomas including uterine endometrioid carcinomas, and mounting evidence supports an immuno-inhibitory role in ovarian cancer prognosis. Recently, B7-H3 expression has been reported in several human cancers indicating an additional function of B7-H3 as a regulator of antitumor immunity.

    Immune Checkpoint
    Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: ICC Antibodies   Immune Checkpoint Detection: IP Antibodies   Immune Checkpoint Detection: FCM Antibodies   Immune Checkpoint Detection: WB Antibodies
    Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

    Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    References
  • Suh WK, et al. (2004) The immune regulatory protein B7-H3 promotes osteoblast differentiation and bone mineralization. Proc Natl Acad Sci U S A. 101(35): 12969-73.
  • Waschbisch A, et al. (2008) Human muscle cells express the costimulatory molecule B7-H3, which modulates muscle-immune interactions. Arthritis Rheum. 58(11): 3600-8.
  • Loos M, et al. (2010) B7-h3 and its role in antitumor immunity. Clin Dev Immunol. 2010: 683875.
  • Zang X, et al. (2010) Tumor associated endothelial expression of B7-H3 predicts survival in ovarian carcinomas. Mod Pathol. 23(8): 1104-12.
  • Sun J, et al. (2010) Clinical significance and regulation of the costimulatory molecule B7-H3 in human colorectal carcinoma. Cancer Immunol Immunother. 59(8): 1163-71.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"