CD164 cDNA ORF Clone, Rat, N-His tag

Cat: RG80354-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD164 Reagents
CRO Services
Product recommended

All CD164 Reagents
CD164 cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
588 bp
Description
Full length Clone DNA of Rat CD164 molecule, sialomucin with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD164 Background Information

Sialomucin core protein 24 also known as endolyn or CD164 (cluster of differentiation 164) is a novel 80- to 90-kD mucin-like molecule expressed by human CD34+ hematopoietic progenitor cells. Isoform 1 and isoform 3 of CD164 are expressed in hematopoietic and non-hematopoietic tissues. Isoform 1 is expressed by prostate cancer tumors and prostate cancer cell lines. The expression is greater in bone metastases than in primary tumors. Expression in osseous metastasis is greater than that in soft tissue metastasis. Isoform 2 of CD164 is expressed in the small intestine, colon, lung, thyroid and in colorectal and pancreatic adenocarcinoma. Isoform 4 is expressed by both hematopoietic progenitor cells and bone marrow stromal cells. CD164 belongs to the CD164 family. The cluster of differentiation (cluster of designation) (often abbreviated as CD) is a protocol used for the identification and investigation of cell surface molecules present on white blood cells initially but found in almost any kind of cell of the body, providing targets for immunophenotyping of cells. CD164 may play an important role in prostate cancer metastasis and the infiltration of bone marrow by cancer cells. CD164 promotes myogenesis by enhancing CXCR4-dependent cell motility. This protein positively regulates myoblast migration and promotes myoblast fusion into myotubes. CD164 may play a key role in hematopoiesis by facilitating the adhesion of CD34+ cells to bone marrow stroma and by negatively regulating CD34+hematopoietic progenitor cell growth.

Full Name
CD164 molecule, sialomucin
References
  • McGuckin CP, et al. (2003) Colocalization analysis of sialomucins CD34 and CD164. Stem Cells. 21(2): 162-70.
  • Doyonnas R, et al. (2000) CD164 monoclonal antibodies that block hemopoietic progenitor cell adhesion and proliferation interact with the first mucin domain of the CD164 receptor. J Immunol. 165(2): 840-51.
  • Zannettino AC, et al. (1998) The sialomucin CD164 (MGC-24v) is an adhesive glycoprotein expressed by human hematopoietic progenitors and bone marrow stromal cells that serves as a potent negative regulator of hematopoiesis. Blood. 92(8): 2613-28.
  • CD164 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD164 cDNA ORF Clone in Cloning Vector, Rat RG80354-G
    CD164 cDNA ORF Clone, Rat, untagged RG80354-UT
    CD164 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80354-ACGLN
    CD164 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80354-ACG
    CD164 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80354-ACR
    CD164 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80354-CF
    CD164 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80354-NF
    CD164 cDNA ORF Clone, Rat, C-His tag RG80354-CH
    CD164 cDNA ORF Clone, Rat, C-HA tag RG80354-CY
    CD164 cDNA ORF Clone, Rat, N-HA tag RG80354-NY
    CD164 cDNA ORF Clone, Rat, C-Myc tag RG80354-CM
    CD164 cDNA ORF Clone, Rat, N-Myc tag RG80354-NM
    CD164 qPCR Primer Pairs, Rat RP300324

    CD164 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD164 cDNA ORF Clone in Cloning Vector, Mouse MG5A1578-U
    CD164 cDNA ORF Clone, Mouse, untagged MG5A1578-UT
    CD164 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1578-ACG
    CD164 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1578-ACGLN
    CD164 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A1578-ACR
    CD164 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A1578-CF
    CD164 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A1578-NF
    CD164 cDNA ORF Clone, Mouse, C-His tag MG5A1578-CH
    CD164 cDNA ORF Clone, Mouse, N-His tag MG5A1578-NH
    CD164 cDNA ORF Clone, Mouse, C-HA tag MG5A1578-CY
    CD164 cDNA ORF Clone, Mouse, N-HA tag MG5A1578-NY
    CD164 cDNA ORF Clone, Mouse, C-Myc tag MG5A1578-CM
    CD164 cDNA ORF Clone, Mouse, N-Myc tag MG5A1578-NM

    CD164 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD164 cDNA ORF Clone in Cloning Vector, Human HG12260-G
    CD164 cDNA ORF Clone, Human, untagged HG12260-UT
    CD164 cDNA ORF Clone, Human, C-GFPSpark® tag HG12260-ACG
    CD164 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12260-ACGLN
    CD164 cDNA ORF Clone, Human, C-OFPSpark® tag HG12260-ACR
    CD164 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12260-CF
    CD164 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12260-NF
    CD164 cDNA ORF Clone, Human, C-His tag HG12260-CH
    CD164 cDNA ORF Clone, Human, N-His tag HG12260-NH
    CD164 cDNA ORF Clone, Human, C-HA tag HG12260-CY
    CD164 cDNA ORF Clone, Human, N-HA tag HG12260-NY
    CD164 cDNA ORF Clone, Human, C-Myc tag HG12260-CM
    CD164 cDNA ORF Clone, Human, N-Myc tag HG12260-NM
    CD164 qPCR Primer Pairs, Human HP101926
    info info
    添加购物车成功! 添加购物车失败!