CCR7/CD197 cDNA ORF Clone, Rat, untagged

Cat: RG80360-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CCR7/CD197 Reagents
CRO Services
Product recommended

All CCR7/CD197 Reagents
CCR7/CD197 cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1137 bp
Description
Full length Clone DNA of Rat chemokine (C-C motif) receptor 7.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CCR7/CD197 Background Information
Full Name
chemokine (C-C motif) receptor 7

CCR7/CD197 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
CCR7/CD197 cDNA ORF Clone in Cloning Vector, Rhesus CG90241-G
CCR7/CD197 cDNA ORF Clone, Rhesus, untagged CG90241-UT
CCR7/CD197 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90241-ACG
CCR7/CD197 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90241-ACGLN
CCR7/CD197 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90241-ACR
CCR7/CD197 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90241-CF
CCR7/CD197 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90241-NF
CCR7/CD197 cDNA ORF Clone, Rhesus, C-His tag CG90241-CH
CCR7/CD197 cDNA ORF Clone, Rhesus, N-His tag CG90241-NH
CCR7/CD197 cDNA ORF Clone, Rhesus, C-HA tag CG90241-CY
CCR7/CD197 cDNA ORF Clone, Rhesus, N-HA tag CG90241-NY
CCR7/CD197 cDNA ORF Clone, Rhesus, C-Myc tag CG90241-CM
CCR7/CD197 cDNA ORF Clone, Rhesus, N-Myc tag CG90241-NM

CCR7/CD197 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CCR7/CD197 cDNA ORF Clone in Cloning Vector, Rat RG80360-G
CCR7/CD197 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80360-ACGLN
CCR7/CD197 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80360-ACG
CCR7/CD197 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80360-ACR
CCR7/CD197 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80360-CF
CCR7/CD197 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80360-NF
CCR7/CD197 cDNA ORF Clone, Rat, C-His tag RG80360-CH
CCR7/CD197 cDNA ORF Clone, Rat, N-His tag RG80360-NH
CCR7/CD197 cDNA ORF Clone, Rat, C-HA tag RG80360-CY
CCR7/CD197 cDNA ORF Clone, Rat, N-HA tag RG80360-NY
CCR7/CD197 cDNA ORF Clone, Rat, C-Myc tag RG80360-CM
CCR7/CD197 cDNA ORF Clone, Rat, N-Myc tag RG80360-NM
CCR7/CD197 qPCR Primer Pairs, Rat RP300330

CCR7/CD197 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CCR7/CD197 cDNA ORF Clone in Cloning Vector, Mouse MG50873-G
CCR7/CD197 cDNA ORF Clone, Mouse, untagged MG50873-UT
CCR7/CD197 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50873-ACGLN
CCR7/CD197 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50873-ACG
CCR7/CD197 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50873-ACR
CCR7/CD197 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50873-CF
CCR7/CD197 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50873-NF
CCR7/CD197 cDNA ORF Clone, Mouse, C-His tag MG50873-CH
CCR7/CD197 cDNA ORF Clone, Mouse, N-His tag MG50873-NH
CCR7/CD197 cDNA ORF Clone, Mouse, C-HA tag MG50873-CY
CCR7/CD197 cDNA ORF Clone, Mouse, N-HA tag MG50873-NY
CCR7/CD197 cDNA ORF Clone, Mouse, C-Myc tag MG50873-CM
CCR7/CD197 cDNA ORF Clone, Mouse, N-Myc tag MG50873-NM
CCR7/CD197 qPCR Primer Pairs, Mouse MP200844

CCR7/CD197 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CCR7/CD197 cDNA ORF Clone in Cloning Vector, Human HG12112-G
CCR7/CD197 cDNA ORF Clone, Human, untagged HG12112-UT
CCR7/CD197 cDNA ORF Clone, Human, C-GFPSpark® tag HG12112-ACG
CCR7/CD197 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12112-ACGLN
CCR7/CD197 cDNA ORF Clone, Human, C-OFPSpark® tag HG12112-ACR
CCR7/CD197 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12112-CF
CCR7/CD197 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12112-NF
CCR7/CD197 cDNA ORF Clone, Human, C-His tag HG12112-CH
CCR7/CD197 cDNA ORF Clone, Human, N-His tag HG12112-NH
CCR7/CD197 cDNA ORF Clone, Human, C-HA tag HG12112-CY
CCR7/CD197 cDNA ORF Clone, Human, N-HA tag HG12112-NY
CCR7/CD197 cDNA ORF Clone, Human, C-Myc tag HG12112-CM
CCR7/CD197 cDNA ORF Clone, Human, N-Myc tag HG12112-NM
CCR7/CD197 qPCR Primer Pairs, Human HP101639
info info
添加购物车成功! 添加购物车失败!