CCR6 cDNA ORF Clone, Rat, N-His tag

Cat: RG80359-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CCR6 Reagents
CRO Services
Product recommended

All CCR6 Reagents
CCR6 cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1101 bp
Description
Full length Clone DNA of Rat chemokine (C-C motif) receptor 6 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CCR6 Background Information
Full Name
chemokine (C-C motif) receptor 6

CCR6 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CCR6 cDNA ORF Clone in Cloning Vector, Rat RG80359-G
CCR6 cDNA ORF Clone, Rat, untagged RG80359-UT
CCR6 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80359-ACG
CCR6 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80359-ACGLN
CCR6 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80359-ACR
CCR6 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80359-CF
CCR6 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80359-NF
CCR6 cDNA ORF Clone, Rat, C-His tag RG80359-CH
CCR6 cDNA ORF Clone, Rat, C-HA tag RG80359-CY
CCR6 cDNA ORF Clone, Rat, N-HA tag RG80359-NY
CCR6 cDNA ORF Clone, Rat, C-Myc tag RG80359-CM
CCR6 cDNA ORF Clone, Rat, N-Myc tag RG80359-NM
CCR6 qPCR Primer Pairs, Rat RP300329

CCR6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CCR6 cDNA ORF Clone in Cloning Vector, Mouse MG50872-G
CCR6 cDNA ORF Clone, Mouse, untagged MG50872-UT
CCR6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50872-ACG
CCR6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50872-ACGLN
CCR6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50872-ACR
CCR6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50872-CF
CCR6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50872-NF
CCR6 cDNA ORF Clone, Mouse, C-His tag MG50872-CH
CCR6 cDNA ORF Clone, Mouse, N-His tag MG50872-NH
CCR6 cDNA ORF Clone, Mouse, C-HA tag MG50872-CY
CCR6 cDNA ORF Clone, Mouse, N-HA tag MG50872-NY
CCR6 cDNA ORF Clone, Mouse, C-Myc tag MG50872-CM
CCR6 cDNA ORF Clone, Mouse, N-Myc tag MG50872-NM
CCR6 qPCR Primer Pairs, Mouse MP200843

CCR6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CCR6 cDNA ORF Clone in Cloning Vector, Human HG11438-M
CCR6 cDNA ORF Clone, Human, untagged HG11438-UT
CCR6 cDNA ORF Clone, Human, C-GFPSpark® tag HG11438-ACG
CCR6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11438-ACGLN
CCR6 cDNA ORF Clone, Human, C-OFPSpark® tag HG11438-ACR
CCR6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11438-CF
CCR6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11438-NF
CCR6 cDNA ORF Clone, Human, C-His tag HG11438-CH
CCR6 cDNA ORF Clone, Human, N-His tag HG11438-NH
CCR6 cDNA ORF Clone, Human, C-HA tag HG11438-CY
CCR6 cDNA ORF Clone, Human, N-HA tag HG11438-NY
CCR6 cDNA ORF Clone, Human, C-Myc tag HG11438-CM
CCR6 cDNA ORF Clone, Human, N-Myc tag HG11438-NM
CCR6 qPCR Primer Pairs, Human HP101315
info info
添加购物车成功! 添加购物车失败!