Quick Order

Rat CCR4 Gene ORF cDNA clone expression plasmid, C-HA tag

    DatasheetReviewsRelated ProductsProtocols
    Rat CCR4 cDNA Clone Product Information
    NCBI RefSeq:NM_133532.2
    RefSeq ORF Size:1083bp
    cDNA Description:Full length Clone DNA of Rattus norvegicus chemokine (C-C motif) receptor 4 with C terminal HA tag.
    Gene Synonym:Cmkbr4, Ccr4
    Species:Rat
    Vector:pCMV3-C-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CCR4 qPCR primers for gene expression analysis, RP300327 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Background

    CCR4 is a chemokine receptor that has a critical role in immune cell trafficking. T-helper type 2 cells (Th2), regulatory T cells (Treg), interluekin-17–producing T-helper cells (Th17), and skin-homing memory T cells express CCR4 on their surface and migrate toward the chemokines CCL17 and CCL22.
    CCR4, a C-C type chemokine receptor, has previously been focused on its biological function in immunopathogenesis of hematological tumors. To date, relatively little attention has been paid to the role of CCR4 in promoting metastasis of some solid tumors, including gastric cancer. Our group has shown that the lymphocyte-rich gastric cancers tend to be more frequently positive for CCR4, and found a novel role of CCR4 in tumor-induced immunosuppression, indicating various expression profiles of CCR4 in gastric cancer tissues and multifunctional roles of this molecule in gastric cancer progression.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    References
  • Yang Y, Du L, Yang X, et al. Aberrant CCR4 Expression Is Involved in Tumor Invasion of Lymph Node-Negative Human Gastric Cancer. Tang C-H, ed. PLoS ONE. 2015;10(3):e0120059. doi:10.1371/journal.pone.0120059.
  • Nakagawa M, Schmitz R, Xiao W, et al. Gain-of-function CCR4 mutations in adult T cell leukemia/lymphoma. The Journal of Experimental Medicine. 2014;211(13):2497-2505.
  • Size / Price
    Catalog: RG80357-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"