Caveolin-1 cDNA ORF Clone, Rat, C-His tag

Cat: RG80557-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Caveolin-1 Reagents
CRO Services
Product recommended

All Caveolin-1 Reagents
Caveolin-1 cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
537 bp
Description
Full length Clone DNA of Rat caveolin 1, caveolae protein with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Caveolin-1 Background Information
Full Name
caveolin 1, caveolae protein, 22kDa

Caveolin-1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Caveolin-1 cDNA ORF Clone in Cloning Vector, Rat RG81403-G
Caveolin-1 cDNA ORF Clone in Cloning Vector, Rat RG80557-U
Caveolin-1 cDNA ORF Clone, Rat, untagged RG80557-UT
Caveolin-1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80557-ACGLN
Caveolin-1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80557-ACG
Caveolin-1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80557-ANG
Caveolin-1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80557-ACR
Caveolin-1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80557-ANR
Caveolin-1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80557-CF
Caveolin-1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80557-NF
Caveolin-1 cDNA ORF Clone, Rat, N-His tag RG80557-NH
Caveolin-1 cDNA ORF Clone, Rat, C-HA tag RG80557-CY
Caveolin-1 cDNA ORF Clone, Rat, N-HA tag RG80557-NY
Caveolin-1 cDNA ORF Clone, Rat, C-Myc tag RG80557-CM
Caveolin-1 cDNA ORF Clone, Rat, N-Myc tag RG80557-NM
Caveolin-1 qPCR Primer Pairs, Rat RP300521

Caveolin-1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Caveolin-1 cDNA ORF Clone in Cloning Vector, Mouse MG53027-G
Caveolin-1 cDNA ORF Clone, Mouse, untagged MG53027-UT
Caveolin-1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53027-ACG
Caveolin-1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53027-ACGLN
Caveolin-1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53027-ACR
Caveolin-1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53027-CF
Caveolin-1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53027-NF
Caveolin-1 cDNA ORF Clone, Mouse, C-His tag MG53027-CH
Caveolin-1 cDNA ORF Clone, Mouse, N-His tag MG53027-NH
Caveolin-1 cDNA ORF Clone, Mouse, C-HA tag MG53027-CY
Caveolin-1 cDNA ORF Clone, Mouse, N-HA tag MG53027-NY
Caveolin-1 cDNA ORF Clone, Mouse, C-Myc tag MG53027-CM
Caveolin-1 cDNA ORF Clone, Mouse, N-Myc tag MG53027-NM

Caveolin-1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Caveolin-1 cDNA ORF Clone in Cloning Vector, Human HG11440-M
Caveolin-1 cDNA ORF Clone, Human, untagged HG11440-UT
Caveolin-1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11440-ACG
Caveolin-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11440-ACGLN
Caveolin-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11440-CF
Caveolin-1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11440-NF
Caveolin-1 cDNA ORF Clone, Human, C-His tag HG11440-CH
Caveolin-1 cDNA ORF Clone, Human, N-His tag HG11440-NH
Caveolin-1 cDNA ORF Clone, Human, C-HA tag HG11440-CY
Caveolin-1 cDNA ORF Clone, Human, N-HA tag HG11440-NY
Caveolin-1 cDNA ORF Clone, Human, C-Myc tag HG11440-CM
Caveolin-1 cDNA ORF Clone, Human, N-Myc tag HG11440-NM
Caveolin-1 qPCR Primer Pairs, Human HP101317
info info
添加购物车成功! 添加购物车失败!