Caspase-14 cDNA ORF Clone, Rat, N-HA tag

Cat: RG80602-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Caspase-14 Reagents
CRO Services
Product recommended

All Caspase-14 Reagents
Caspase-14 cDNA ORF Clone, Rat, N-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
741 bp
Description
Full length Clone DNA of Rat caspase 14 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Caspase-14 Background Information

Caspase 14 is a member of the caspase family. Caspases are a kind of cysteine proteinase consisting of a prodomain plus large and small catalytic subunits, that play a central role in cell apoptosis. Caspase 14 possesses an unusually short prodomain and is highly expressed in embryonic tissues but absent from most of the adult tissues except for the skin, which suggests a role in ontogenesis and skin physiology. Unlike the other short prodomain caspases(caspase-3, caspase-6, and caspase-7), Caspase 14 was not processed by multiple death stimuli including activation of members of the tumor necrosis factor receptor family and expression of proapaptotic members of the bcl-2 family. Caspase 14 has been described to be processed and activated by anti-Fas agonist antibody or TNF-related apoptosis inducing ligand in vivo. The expression and processing of this caspase may take part in keratinocyte terminal differentiation, which is essential for the skin barrier.

Full Name
caspase 14, apoptosis-related cysteine peptidase
References
  • Hu SM, et al. (1998) Caspase-14 is a novel developmentally regulated protease. The journal of biological chemistry. 273: 29648-53.
  • Marc Van De Craen, et al. (1998) Identification of a new caspase homologue: caspase-14. Cell death differ. 5(10): 838-46.
  • Caspase-14 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Caspase-14 cDNA ORF Clone in Cloning Vector, Rat RG80602-U
    Caspase-14 cDNA ORF Clone, Rat, untagged RG80602-UT
    Caspase-14 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80602-ACGLN
    Caspase-14 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80602-ACG
    Caspase-14 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80602-ANG
    Caspase-14 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80602-ACR
    Caspase-14 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80602-ANR
    Caspase-14 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80602-CF
    Caspase-14 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80602-NF
    Caspase-14 cDNA ORF Clone, Rat, C-His tag RG80602-CH
    Caspase-14 cDNA ORF Clone, Rat, N-His tag RG80602-NH
    Caspase-14 cDNA ORF Clone, Rat, C-HA tag RG80602-CY
    Caspase-14 cDNA ORF Clone, Rat, C-Myc tag RG80602-CM
    Caspase-14 cDNA ORF Clone, Rat, N-Myc tag RG80602-NM
    Caspase-14 qPCR Primer Pairs, Rat RP300566

    Caspase-14 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Caspase-14 cDNA ORF Clone, Mouse, untagged MG59849-UT
    Caspase-14 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59849-ACG
    Caspase-14 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59849-ACGLN
    Caspase-14 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG59849-ANG
    Caspase-14 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59849-ACR
    Caspase-14 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG59849-ANR
    Caspase-14 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59849-CF
    Caspase-14 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59849-NF
    Caspase-14 cDNA ORF Clone, Mouse, C-His tag MG59849-CH
    Caspase-14 cDNA ORF Clone, Mouse, N-His tag MG59849-NH
    Caspase-14 cDNA ORF Clone, Mouse, C-HA tag MG59849-CY
    Caspase-14 cDNA ORF Clone, Mouse, N-HA tag MG59849-NY
    Caspase-14 cDNA ORF Clone, Mouse, C-Myc tag MG59849-CM
    Caspase-14 cDNA ORF Clone, Mouse, N-Myc tag MG59849-NM

    Caspase-14 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Caspase-14 cDNA ORF Clone, Human, untagged HG11856-UT
    Caspase-14 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11856-ACGLN
    Caspase-14 qPCR Primer Pairs, Human HP100029
    info info
    添加购物车成功! 添加购物车失败!