Carbonic anhydrase II cDNA ORF Clone, Rat, N-His tag

Cat: RG80611-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Carbonic anhydrase II Reagents
CRO Services
Product recommended

All Carbonic anhydrase II Reagents
Carbonic anhydrase II cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
783 bp
Description
Full length Clone DNA of Rat carbonic anhydrase 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Carbonic anhydrase II Background Information

The carbonic anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and form a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that takes part in maintaining acid-base balance in blood and other tissues. The carbonic anhydrasekl (CA) family consists of at least 11 enzymatically active members and a few inactive homologous proteins. Carbonic anhydrase II is one of fourteen forms of human α carbonic anhydrases. Defects in this enzyme are associated with osteopetrosis and renal tubular acidosis. Renal carbonic anhydrase allows the reabsorption of sodium ions in the proximal tubule. Carbonic anhydrase II has been shown to interact with Band 3 and Sodium-hydrogen antiporter 1.

Full Name
carbonic anhydrase II
References
  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Lindskog S. (1997) Structure and mechanism of carbonic anhydrase. Pharmacology & Therapeutics. 74(1):1-20.
  • Lilias A, et al. (1972) Crystal Structure of Human Carbonic Anhydrase C. Nature new biology. 235: 131-7.
  • Li XJ, et al. (2002) Carbonic Anhydrase II Binds to and Enhances Activity of the Na+/H+ Exchanger. The Journal of Biological Chemistry. 277: 36085-91.
  • Carbonic anhydrase II cDNA ORF Clone, Ferret, Related Products

    Product Name Catalog#(PDF)
    Carbonic anhydrase II cDNA ORF Clone in Cloning Vector, Ferret FG60084-G
    Carbonic anhydrase II cDNA ORF Clone, Ferret, untagged FG60084-UT
    Carbonic anhydrase II Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60084-ACGLN
    Carbonic anhydrase II cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60084-ACG
    Carbonic anhydrase II cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60084-ANG
    Carbonic anhydrase II cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60084-ACR
    Carbonic anhydrase II cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60084-ANR
    Carbonic anhydrase II cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60084-CF
    Carbonic anhydrase II cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60084-NF
    Carbonic anhydrase II cDNA ORF Clone, Ferret, C-His tag FG60084-CH
    Carbonic anhydrase II cDNA ORF Clone, Ferret, N-His tag FG60084-NH
    Carbonic anhydrase II cDNA ORF Clone, Ferret, C-HA tag FG60084-CY
    Carbonic anhydrase II cDNA ORF Clone, Ferret, N-HA tag FG60084-NY
    Carbonic anhydrase II cDNA ORF Clone, Ferret, C-Myc tag FG60084-CM
    Carbonic anhydrase II cDNA ORF Clone, Ferret, N-Myc tag FG60084-NM

    Carbonic anhydrase II cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Carbonic anhydrase II cDNA ORF Clone in Cloning Vector, Rat RG80611-U
    Carbonic anhydrase II cDNA ORF Clone, Rat, untagged RG80611-UT
    Carbonic anhydrase II cDNA ORF Clone, Rat, C-GFPSpark® tag RG80611-ACG
    Carbonic anhydrase II Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80611-ACGLN
    Carbonic anhydrase II cDNA ORF Clone, Rat, C-OFPSpark® tag RG80611-ACR
    Carbonic anhydrase II cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80611-CF
    Carbonic anhydrase II cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80611-NF
    Carbonic anhydrase II cDNA ORF Clone, Rat, C-His tag RG80611-CH
    Carbonic anhydrase II cDNA ORF Clone, Rat, C-HA tag RG80611-CY
    Carbonic anhydrase II cDNA ORF Clone, Rat, N-HA tag RG80611-NY
    Carbonic anhydrase II cDNA ORF Clone, Rat, C-Myc tag RG80611-CM
    Carbonic anhydrase II cDNA ORF Clone, Rat, N-Myc tag RG80611-NM
    Carbonic anhydrase II qPCR Primer Pairs, Rat RP300575

    Carbonic anhydrase II cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Carbonic anhydrase II cDNA ORF Clone in Cloning Vector, Mouse MG50685-G
    Carbonic anhydrase II cDNA ORF Clone, Mouse, untagged MG50685-UT
    Carbonic anhydrase II cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50685-ACG
    Carbonic anhydrase II Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50685-ACGLN
    Carbonic anhydrase II cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50685-ANG
    Carbonic anhydrase II cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50685-ACR
    Carbonic anhydrase II cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50685-ANR
    Carbonic anhydrase II cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50685-CF
    Carbonic anhydrase II cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50685-NF
    Carbonic anhydrase II cDNA ORF Clone, Mouse, C-His tag MG50685-CH
    Carbonic anhydrase II cDNA ORF Clone, Mouse, N-His tag MG50685-NH
    Carbonic anhydrase II cDNA ORF Clone, Mouse, C-HA tag MG50685-CY
    Carbonic anhydrase II cDNA ORF Clone, Mouse, N-HA tag MG50685-NY
    Carbonic anhydrase II cDNA ORF Clone, Mouse, C-Myc tag MG50685-CM
    Carbonic anhydrase II cDNA ORF Clone, Mouse, N-Myc tag MG50685-NM
    Carbonic anhydrase II qPCR Primer Pairs, Mouse MP200663

    Carbonic anhydrase II cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Carbonic anhydrase II cDNA ORF Clone in Cloning Vector, Human HG10478-M
    Carbonic anhydrase II cDNA ORF Clone, Human, untagged HG10478-UT
    Carbonic anhydrase II cDNA ORF Clone, Human, C-GFPSpark® tag HG10478-ACG
    Carbonic anhydrase II Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10478-ACGLN
    Carbonic anhydrase II cDNA ORF Clone, Human, N-GFPSpark® tag HG10478-ANG
    Carbonic anhydrase II cDNA ORF Clone, Human, C-OFPSpark® tag HG10478-ACR
    Carbonic anhydrase II cDNA ORF Clone, Human, N-OFPSpark® tag HG10478-ANR
    Carbonic anhydrase II cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10478-CF
    Carbonic anhydrase II cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10478-NF
    Carbonic anhydrase II cDNA ORF Clone, Human, C-His tag HG10478-CH
    Carbonic anhydrase II cDNA ORF Clone, Human, N-His tag HG10478-NH
    Carbonic anhydrase II cDNA ORF Clone, Human, C-HA tag HG10478-CY
    Carbonic anhydrase II cDNA ORF Clone, Human, N-HA tag HG10478-NY
    Carbonic anhydrase II cDNA ORF Clone, Human, C-Myc tag HG10478-CM
    Carbonic anhydrase II cDNA ORF Clone, Human, N-Myc tag HG10478-NM
    Carbonic anhydrase II qPCR Primer Pairs, Human HP100500
    info info
    添加购物车成功! 添加购物车失败!