CAPZA2 cDNA ORF Clone, Rat, C-HA tag

Cat: RG80670-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CAPZA2 Reagents
CRO Services
Product recommended

All CAPZA2 Reagents
CAPZA2 cDNA ORF Clone, Rat, C-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
861 bp
Description
Full length Clone DNA of Rat capping protein (actin filament) muscle Z-line, alpha 2 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CAPZA2 Background Information
Full Name
capping protein (actin filament) muscle Z-line, alpha 2

CAPZA2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CAPZA2 cDNA ORF Clone in Cloning Vector, Rat RG80670-U
CAPZA2 cDNA ORF Clone, Rat, untagged RG80670-UT
CAPZA2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80670-ACG
CAPZA2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80670-ACGLN
CAPZA2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80670-ANG
CAPZA2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80670-ACR
CAPZA2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80670-ANR
CAPZA2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80670-CF
CAPZA2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80670-NF
CAPZA2 cDNA ORF Clone, Rat, C-His tag RG80670-CH
CAPZA2 cDNA ORF Clone, Rat, N-His tag RG80670-NH
CAPZA2 cDNA ORF Clone, Rat, N-HA tag RG80670-NY
CAPZA2 cDNA ORF Clone, Rat, C-Myc tag RG80670-CM
CAPZA2 cDNA ORF Clone, Rat, N-Myc tag RG80670-NM
CAPZA2 qPCR Primer Pairs, Rat RP300634

CAPZA2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CAPZA2 cDNA ORF Clone in Cloning Vector, Mouse MG51697-G
CAPZA2 cDNA ORF Clone, Mouse, untagged MG51697-UT
CAPZA2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51697-ACGLN
CAPZA2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51697-ACG
CAPZA2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51697-ANG
CAPZA2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51697-ACR
CAPZA2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51697-ANR
CAPZA2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51697-CF
CAPZA2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51697-NF
CAPZA2 cDNA ORF Clone, Mouse, C-His tag MG51697-CH
CAPZA2 cDNA ORF Clone, Mouse, N-His tag MG51697-NH
CAPZA2 cDNA ORF Clone, Mouse, C-HA tag MG51697-CY
CAPZA2 cDNA ORF Clone, Mouse, N-HA tag MG51697-NY
CAPZA2 cDNA ORF Clone, Mouse, C-Myc tag MG51697-CM
CAPZA2 cDNA ORF Clone, Mouse, N-Myc tag MG51697-NM
CAPZA2 qPCR Primer Pairs, Mouse MP201570

CAPZA2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CAPZA2 cDNA ORF Clone in Cloning Vector, Human HG15416-G
CAPZA2 cDNA ORF Clone, Human, untagged HG15416-UT
CAPZA2 cDNA ORF Clone, Human, C-GFPSpark® tag HG15416-ACG
CAPZA2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15416-ACGLN
CAPZA2 cDNA ORF Clone, Human, N-GFPSpark® tag HG15416-ANG
CAPZA2 cDNA ORF Clone, Human, C-OFPSpark® tag HG15416-ACR
CAPZA2 cDNA ORF Clone, Human, N-OFPSpark® tag HG15416-ANR
CAPZA2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15416-CF
CAPZA2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15416-NF
CAPZA2 cDNA ORF Clone, Human, C-His tag HG15416-CH
CAPZA2 cDNA ORF Clone, Human, N-His tag HG15416-NH
CAPZA2 cDNA ORF Clone, Human, C-HA tag HG15416-CY
CAPZA2 cDNA ORF Clone, Human, N-HA tag HG15416-NY
CAPZA2 cDNA ORF Clone, Human, C-Myc tag HG15416-CM
CAPZA2 cDNA ORF Clone, Human, N-Myc tag HG15416-NM
CAPZA2 qPCR Primer Pairs, Human HP104040
info info
添加购物车成功! 添加购物车失败!