C1s cDNA ORF Clone, Rat, untagged

Cat: RG81198-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All C1s Reagents
CRO Services
Product recommended

All C1s Reagents
C1s cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2085 bp
Description
Full length Clone DNA of Rat complement component 1, s subcomponent.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

C1s Background Information

Complement is an integral component of the adaptive and innate immune systems and represents one of the major effector systems for the immune responses. The classical complement pathway is triggered by C1, a complex composed of the binding protein C1q and two proenzymes, C1r and C1s. Upon binding of IgG to the head of C1q, C1r undergoes autoactivation and in turn cleaves and activates C1s. C1r and C1s, the proteases responsible for activation and proteolytic activity of the C1 complex of complement, share similar overall structural organizations featuring five nonenzymic protein modules (two CUB modules surrounding a single EGF module, and a pair of CCP modules) followed by a serine protease domain. Besides highly specific proteolytic activities, both proteases exhibit interaction properties associated with their N-terminal regions. In contrast, C1r and C1s widely differ from each other by their glycosylation patterns: both proteins contain Asn-linked carbohydrates, but four glycosylation sites are present on C1r, and only two on C1s. As a highly specific serine protease, C1s executes the catalytic function of the C1 complex: the cleavage of C4 and C2, and thus instigates a sequence of activation steps of other components of the complement system, culminating in the formation of the membrane attack complex which induces cell lysis. Like other complement serine proteases C1s has restricted substrate specificity and it is engaged into specific interactions with other subcomponents of the complement system. The only other protein known to interact with C1s physiologically is SerpinC1, an inhibitor of serine protease, which inhibits C1s activity and thus plays a regulatory role in controlling the function of C1s enzyme.

Full Name
complement component 1, s subcomponent
References
  • Arlaud GJ, et al. (1989) Structure and function of C1r and C1s: current concepts. Behring Inst Mitt. (84): 56-64.
  • Thielens NM, et al. (1999) Structure and functions of the interaction domains of C1r and C1s: keystones of the architecture of the C1 complex. Immunopharmacology. 42(1-3): 3-13.
  • Gl P, et al. (2002) C1s, the protease messenger of C1. Structure, function and physiological significance. Immunobiology. 205(4-5): 383-94.
  • C1s cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    C1s cDNA ORF Clone in Cloning Vector, Rat RG81198-U
    C1s Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81198-ACGLN
    C1s cDNA ORF Clone, Rat, C-GFPSpark® tag RG81198-ACG
    C1s cDNA ORF Clone, Rat, C-OFPSpark® tag RG81198-ACR
    C1s cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81198-CF
    C1s cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81198-NF
    C1s cDNA ORF Clone, Rat, C-His tag RG81198-CH
    C1s cDNA ORF Clone, Rat, N-His tag RG81198-NH
    C1s cDNA ORF Clone, Rat, C-HA tag RG81198-CY
    C1s cDNA ORF Clone, Rat, N-HA tag RG81198-NY
    C1s cDNA ORF Clone, Rat, C-Myc tag RG81198-CM
    C1s cDNA ORF Clone, Rat, N-Myc tag RG81198-NM
    C1s qPCR Primer Pairs, Rat RP301154

    C1s cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    C1s cDNA ORF Clone in Cloning Vector, Mouse MG50979-G
    C1s cDNA ORF Clone, Mouse, untagged MG50979-UT
    C1s Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50979-ACGLN
    C1s cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50979-ACG
    C1s cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50979-ACR
    C1s cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50979-CF
    C1s cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50979-NF
    C1s cDNA ORF Clone, Mouse, C-His tag MG50979-CH
    C1s cDNA ORF Clone, Mouse, N-His tag MG50979-NH
    C1s cDNA ORF Clone, Mouse, C-HA tag MG50979-CY
    C1s cDNA ORF Clone, Mouse, N-HA tag MG50979-NY
    C1s cDNA ORF Clone, Mouse, C-Myc tag MG50979-CM
    C1s cDNA ORF Clone, Mouse, N-Myc tag MG50979-NM
    C1s qPCR Primer Pairs, Mouse MP200947

    C1s cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    C1s cDNA ORF Clone in Cloning Vector, Human HG10220-G
    C1s cDNA ORF Clone, Human, untagged HG10220-UT
    C1s Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10220-ACGLN
    C1s cDNA ORF Clone, Human, C-GFPSpark® tag HG10220-ACG
    C1s cDNA ORF Clone, Human, C-OFPSpark® tag HG10220-ACR
    C1s cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10220-CF
    C1s cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10220-G-F
    C1s cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10220-NF
    C1s cDNA ORF Clone, Human, C-His tag HG10220-CH
    C1s cDNA ORF Clone, Human, N-His tag HG10220-NH
    C1s cDNA ORF Clone, Human, C-HA tag HG10220-CY
    C1s cDNA ORF Clone, Human, N-HA tag HG10220-NY
    C1s cDNA ORF Clone, Human, C-Myc tag HG10220-CM
    C1s cDNA ORF Clone, Human, N-Myc tag HG10220-NM
    C1s qPCR Primer Pairs, Human HP100275
    info info
    添加购物车成功! 添加购物车失败!