BRMS1 cDNA ORF Clone, Rat, untagged

Cat: RG81234-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All BRMS1 Reagents
CRO Services
Product recommended

All BRMS1 Reagents
BRMS1 cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
741 bp
Description
Full length Clone DNA of Rat breast cancer metastasis-suppressor 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BRMS1 Background Information
Full Name
breast cancer metastasis suppressor 1

BRMS1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
BRMS1 cDNA ORF Clone in Cloning Vector, Rat RG81234-U
BRMS1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81234-ACGLN
BRMS1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81234-ACG
BRMS1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81234-ANG
BRMS1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81234-ACR
BRMS1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81234-ANR
BRMS1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81234-CF
BRMS1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81234-NF
BRMS1 cDNA ORF Clone, Rat, C-His tag RG81234-CH
BRMS1 cDNA ORF Clone, Rat, N-His tag RG81234-NH
BRMS1 cDNA ORF Clone, Rat, C-HA tag RG81234-CY
BRMS1 cDNA ORF Clone, Rat, N-HA tag RG81234-NY
BRMS1 cDNA ORF Clone, Rat, C-Myc tag RG81234-CM
BRMS1 cDNA ORF Clone, Rat, N-Myc tag RG81234-NM
BRMS1 qPCR Primer Pairs, Rat RP301190

BRMS1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
BRMS1 cDNA ORF Clone in Cloning Vector, Mouse MG51938-G
BRMS1 cDNA ORF Clone, Mouse, untagged MG51938-UT
BRMS1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51938-ACG
BRMS1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51938-ACGLN
BRMS1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51938-ANG
BRMS1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51938-ACR
BRMS1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51938-ANR
BRMS1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51938-CF
BRMS1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51938-NF
BRMS1 cDNA ORF Clone, Mouse, C-His tag MG51938-CH
BRMS1 cDNA ORF Clone, Mouse, N-His tag MG51938-NH
BRMS1 cDNA ORF Clone, Mouse, C-HA tag MG51938-CY
BRMS1 cDNA ORF Clone, Mouse, N-HA tag MG51938-NY
BRMS1 cDNA ORF Clone, Mouse, C-Myc tag MG51938-CM
BRMS1 cDNA ORF Clone, Mouse, N-Myc tag MG51938-NM
BRMS1 qPCR Primer Pairs, Mouse MP201811

BRMS1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BRMS1 cDNA ORF Clone, Human, untagged HG11359-UT
BRMS1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11359-ACGLN
BRMS1 qPCR Primer Pairs, Human HP104870
info info
添加购物车成功! 添加购物车失败!