BPGM cDNA ORF Clone, Rat, N-His tag

Cat: RG80657-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All BPGM Reagents
CRO Services
Product recommended

All BPGM Reagents
BPGM cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
777 bp
Description
Full length Clone DNA of Rat 2,3-bisphosphoglycerate mutase with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BPGM Background Information
Full Name
2,3-bisphosphoglycerate mutase

BPGM cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
BPGM cDNA ORF Clone in Cloning Vector, Rhesus CG90494-G
BPGM cDNA ORF Clone, Rhesus, untagged CG90494-UT
BPGM Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90494-ACGLN
BPGM cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90494-ACG
BPGM cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90494-ANG
BPGM cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90494-ACR
BPGM cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90494-ANR
BPGM cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90494-CF
BPGM cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90494-NF
BPGM cDNA ORF Clone, Rhesus, C-His tag CG90494-CH
BPGM cDNA ORF Clone, Rhesus, N-His tag CG90494-NH
BPGM cDNA ORF Clone, Rhesus, C-HA tag CG90494-CY
BPGM cDNA ORF Clone, Rhesus, N-HA tag CG90494-NY
BPGM cDNA ORF Clone, Rhesus, C-Myc tag CG90494-CM
BPGM cDNA ORF Clone, Rhesus, N-Myc tag CG90494-NM

BPGM cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
BPGM cDNA ORF Clone in Cloning Vector, Rat RG80657-U
BPGM cDNA ORF Clone, Rat, untagged RG80657-UT
BPGM Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80657-ACGLN
BPGM cDNA ORF Clone, Rat, C-GFPSpark® tag RG80657-ACG
BPGM cDNA ORF Clone, Rat, N-GFPSpark® tag RG80657-ANG
BPGM cDNA ORF Clone, Rat, C-OFPSpark® tag RG80657-ACR
BPGM cDNA ORF Clone, Rat, N-OFPSpark® tag RG80657-ANR
BPGM cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80657-CF
BPGM cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80657-NF
BPGM cDNA ORF Clone, Rat, C-His tag RG80657-CH
BPGM cDNA ORF Clone, Rat, C-HA tag RG80657-CY
BPGM cDNA ORF Clone, Rat, N-HA tag RG80657-NY
BPGM cDNA ORF Clone, Rat, C-Myc tag RG80657-CM
BPGM cDNA ORF Clone, Rat, N-Myc tag RG80657-NM
BPGM qPCR Primer Pairs, Rat RP300621

BPGM cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
BPGM cDNA ORF Clone in Cloning Vector, Mouse MG52410-U
BPGM cDNA ORF Clone, Mouse, untagged MG52410-UT
BPGM Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52410-ACGLN
BPGM cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52410-ACG
BPGM cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52410-ANG
BPGM cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52410-ACR
BPGM cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52410-ANR
BPGM cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52410-CF
BPGM cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52410-NF
BPGM cDNA ORF Clone, Mouse, C-His tag MG52410-CH
BPGM cDNA ORF Clone, Mouse, N-His tag MG52410-NH
BPGM cDNA ORF Clone, Mouse, C-HA tag MG52410-CY
BPGM cDNA ORF Clone, Mouse, N-HA tag MG52410-NY
BPGM cDNA ORF Clone, Mouse, C-Myc tag MG52410-CM
BPGM cDNA ORF Clone, Mouse, N-Myc tag MG52410-NM
BPGM qPCR Primer Pairs, Mouse MP202283

BPGM cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BPGM cDNA ORF Clone in Cloning Vector, Human HG14685-G
BPGM cDNA ORF Clone, Human, untagged HG14685-UT
BPGM cDNA ORF Clone, Human, C-GFPSpark® tag HG14685-ACG
BPGM Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14685-ACGLN
BPGM cDNA ORF Clone, Human, N-GFPSpark® tag HG14685-ANG
BPGM cDNA ORF Clone, Human, C-OFPSpark® tag HG14685-ACR
BPGM cDNA ORF Clone, Human, N-OFPSpark® tag HG14685-ANR
BPGM cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14685-CF
BPGM cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14685-NF
BPGM cDNA ORF Clone, Human, C-His tag HG14685-CH
BPGM cDNA ORF Clone, Human, N-His tag HG14685-NH
BPGM cDNA ORF Clone, Human, C-HA tag HG14685-CY
BPGM cDNA ORF Clone, Human, N-HA tag HG14685-NY
BPGM cDNA ORF Clone, Human, C-Myc tag HG14685-CM
BPGM cDNA ORF Clone, Human, N-Myc tag HG14685-NM
BPGM qPCR Primer Pairs, Human HP103319
info info
添加购物车成功! 添加购物车失败!