BOK cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG80034-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All BOK Reagents
CRO Services
Product recommended

All BOK Reagents
BOK cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
642 bp
Description
Full length Clone DNA of Rat BCL2-related ovarian killer with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BOK Background Information
Full Name
BCL2-related ovarian killer

BOK cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
BOK cDNA ORF Clone in Cloning Vector, Rat RG80034-M
BOK cDNA ORF Clone, Rat, untagged RG80034-UT
BOK Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80034-ACGLN
BOK cDNA ORF Clone, Rat, C-GFPSpark® tag RG80034-ACG
BOK cDNA ORF Clone, Rat, N-GFPSpark® tag RG80034-ANG
BOK cDNA ORF Clone, Rat, C-OFPSpark® tag RG80034-ACR
BOK cDNA ORF Clone, Rat, N-OFPSpark® tag RG80034-ANR
BOK cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80034-NF
BOK cDNA ORF Clone, Rat, C-His tag RG80034-CH
BOK cDNA ORF Clone, Rat, N-His tag RG80034-NH
BOK cDNA ORF Clone, Rat, C-HA tag RG80034-CY
BOK cDNA ORF Clone, Rat, N-HA tag RG80034-NY
BOK cDNA ORF Clone, Rat, C-Myc tag RG80034-CM
BOK cDNA ORF Clone, Rat, N-Myc tag RG80034-NM
BOK qPCR Primer Pairs, Rat RP300033

BOK cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
BOK cDNA ORF Clone in Cloning Vector, Mouse MG5A1707-U
BOK cDNA ORF Clone, Mouse, untagged MG5A1707-UT
BOK cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1707-ACG
BOK Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1707-ACGLN
BOK cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A1707-ANG
BOK cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A1707-ACR
BOK cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A1707-ANR
BOK cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A1707-CF
BOK cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A1707-NF
BOK cDNA ORF Clone, Mouse, C-His tag MG5A1707-CH
BOK cDNA ORF Clone, Mouse, N-His tag MG5A1707-NH
BOK cDNA ORF Clone, Mouse, C-HA tag MG5A1707-CY
BOK cDNA ORF Clone, Mouse, N-HA tag MG5A1707-NY
BOK cDNA ORF Clone, Mouse, C-Myc tag MG5A1707-CM
BOK cDNA ORF Clone, Mouse, N-Myc tag MG5A1707-NM

BOK cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BOK cDNA ORF Clone, Human, untagged HG20096-UT
info info
添加购物车成功! 添加购物车失败!