Quick Order

Rat ALK-6 / BMPR1B Gene ORF cDNA clone expression plasmid, C-Flag tag

    DatasheetReviewsRelated ProductsProtocols
    Rat BMPR1B cDNA Clone Product Information
    NCBI RefSeq:NM_001024259.1
    RefSeq ORF Size:894bp
    cDNA Description:Full length Clone DNA of Rattus norvegicus bone morphogenetic protein receptor, type IB with C terminal Flag tag.
    Gene Synonym:CFK-43a, Bmpr1b
    Species:Rat
    Vector:pCMV3-C-FLAG
    Plasmid:
    Restriction Site:
    Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with BMPR1B qPCR primers for gene expression analysis, RP300125 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Product nameProduct name
    Background

    BMPR1B(bone morphogenetic protein receptor, type IB), also known as ALK6, is a a member of the bone morphogenetic protein (BMP) receptor family. BMPs are involved in endochondral bone formation and embryogenesis. These proteins transduce their signals through the formation of heteromeric complexes of 2 different types of serine (threonine) kinase receptors: type I receptors of about 50-55 kD and type II receptors of about 70-80 kD. Type II receptors bind ligands in the absence of type I receptors, but they require their respective type I receptors for signaling, whereas type I receptors require their respective type II receptors for ligand binding. BMPR1B is the major transducer of signals in precartilaginous condensations as demonstrated in experiments using constitutively active BMPR1B receptors. BMPR1B is a more effective trasducer of GDF5 than BMPR1A. Unlike BMPR1A null mice, which die at an early embryonic stage, BMPR1B null mice are viable.

    References
  • Ide H, et al. (1998) Assignment of the BMPR1A and BMPR1B genes to human chromosome 10q22.3 and 4q23--q24 byin situ hybridization and radiation hybrid map ping. Cytogenet. Cell Genet. 81(3-4): 285-6.
  • Mishina Y, et al. (2004) Bone morphogenetic protein type IA receptor signaling regulates postnatal osteoblast function and bone remodeling. J Biol Chem. 279(26): 27560-6.
  • Yoon BS, et al. (2005) Bmpr1a and Bmpr1b have overlapping functions and are essential for chondrogenesis in vivo. Proc Natl Acad Sci. 102(14): 5062-7.
  • Size / Price
    Catalog: RG80128-CF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"