CD86 cDNA ORF Clone, Rat, C-Myc tag

Cat: RG80025-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CD86 Reagents
CRO Services
Product recommended

All CD86 Reagents
CD86 cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
942 bp
Description
Full length Clone DNA of Rat CD86 molecule with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD86 Background Information

CD86, also known as B-lymphocyte activation antigen B7-2 (referred to as B70), is a member of the cell surface immunoglobulin superfamily. B7-2 exists predominantly as a monomer on cell surfaces and interacts with two co-stimulatory receptors CD28 and cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) expressed on T cells, and thus induces the signal pathways which regulate T cell activation and tolerance, cytokine production, and the generation of CTL. It is indicated that contacts between B and T helper cells mediated by CD86 encourage signals for the proliferation and IgG secretion of normal B cells and B cell lymphomas. Recent study has revealed that CD86 also promotes the generation of a mature APC repertoire and promotes APC function and survival. CD86 has an important role in chronic hemodialysis, allergic pulmonary inflammation, arthritis, and antiviral responses, and thus is regarded as a promising candidate for immune therapy.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: IP Antibodies   Immune Checkpoint Detection: FCM Antibodies   Immune Checkpoint Detection: WB Antibodies
Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
CD86 antigen
References
  • Chen YQ, et al. (2006) CD28/CTLA-4--CD80/CD86 and ICOS--B7RP-1 costimulatory pathway in bronchial asthma. Allergy. 61(1): 15-26.
  • Rau FC, et al. (2009) B7-1/2 (CD80/CD86) direct signaling to B cells enhances IgG secretion. J Immunol. 183(12): 7661-71.
  • Dai ZS, et al. (2009) Defective expression and modulation of B7-2/CD86 on B cells in B cell chronic lymphocytic leukemia. Int J Hematol. 89(5): 656-63.
  • CD86 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CD86 cDNA ORF Clone in Cloning Vector, Rhesus CG90270-G
    CD86 cDNA ORF Clone, Rhesus, untagged CG90270-UT
    CD86 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90270-ACG
    CD86 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90270-ACGLN
    CD86 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90270-ACR
    CD86 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90270-CF
    CD86 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90270-NF
    CD86 cDNA ORF Clone, Rhesus, C-His tag CG90270-CH
    CD86 cDNA ORF Clone, Rhesus, N-His tag CG90270-NH
    CD86 cDNA ORF Clone, Rhesus, C-HA tag CG90270-CY
    CD86 cDNA ORF Clone, Rhesus, N-HA tag CG90270-NY
    CD86 cDNA ORF Clone, Rhesus, C-Myc tag CG90270-CM
    CD86 cDNA ORF Clone, Rhesus, N-Myc tag CG90270-NM

    CD86 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD86 cDNA ORF Clone in Cloning Vector, Rat RG80025-M
    CD86 cDNA ORF Clone, Rat, untagged RG80025-UT
    CD86 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80025-ACG
    CD86 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80025-ACGLN
    CD86 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80025-ACR
    CD86 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80025-CF
    CD86 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80025-NF
    CD86 cDNA ORF Clone, Rat, C-His tag RG80025-CH
    CD86 cDNA ORF Clone, Rat, N-His tag RG80025-NH
    CD86 cDNA ORF Clone, Rat, C-HA tag RG80025-CY
    CD86 cDNA ORF Clone, Rat, N-HA tag RG80025-NY
    CD86 cDNA ORF Clone, Rat, N-Myc tag RG80025-NM
    CD86 qPCR Primer Pairs, Rat RP300024

    CD86 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD86 cDNA ORF Clone in Cloning Vector, Mouse MG50068-M
    CD86 cDNA ORF Clone, Mouse, untagged MG50068-UT
    CD86 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50068-ACG
    CD86 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50068-ACGLN
    CD86 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50068-ACR
    CD86 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50068-CF
    CD86 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50068-NF
    CD86 cDNA ORF Clone, Mouse, C-His tag MG50068-CH
    CD86 cDNA ORF Clone, Mouse, N-His tag MG50068-NH
    CD86 cDNA ORF Clone, Mouse, C-HA tag MG50068-CY
    CD86 cDNA ORF Clone, Mouse, N-HA tag MG50068-NY
    CD86 cDNA ORF Clone, Mouse, C-Myc tag MG50068-CM
    CD86 cDNA ORF Clone, Mouse, N-Myc tag MG50068-NM
    CD86 qPCR Primer Pairs, Mouse MP200099

    CD86 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD86 cDNA ORF Clone in Cloning Vector, Human HG10699-G
    CD86 cDNA ORF Clone, Human, untagged HG10699-UT
    CD86 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10699-ACGLN
    CD86 cDNA ORF Clone, Human, C-GFPSpark® tag HG10699-ACG
    CD86 cDNA ORF Clone, Human, C-OFPSpark® tag HG10699-ACR
    CD86 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10699-CF
    CD86 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10699-NF
    CD86 cDNA ORF Clone, Human, C-His tag HG10699-CH
    CD86 cDNA ORF Clone, Human, N-His tag HG10699-NH
    CD86 cDNA ORF Clone, Human, C-HA tag HG10699-CY
    CD86 cDNA ORF Clone, Human, N-HA tag HG10699-NY
    CD86 cDNA ORF Clone, Human, C-Myc tag HG10699-CM
    CD86 cDNA ORF Clone, Human, N-Myc tag HG10699-NM
    CD86 qPCR Primer Pairs, Human HP100099
    info info
    添加购物车成功! 添加购物车失败!