AKIP/AURKAIP1 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80853-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All AKIP/AURKAIP1 Reagents
CRO Services
Product recommended

All AKIP/AURKAIP1 Reagents
AKIP/AURKAIP1 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
602 bp
Description
Full length Clone DNA of Rat aurora kinase A interacting protein 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AKIP/AURKAIP1 cDNA ORF Clone, Rat, N-Myc tag Alternative Names
Akip cDNA ORF Clone, Rat
AKIP/AURKAIP1 Background Information
Full Name
aurora kinase A interacting protein 1

AKIP/AURKAIP1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
AKIP/AURKAIP1 cDNA ORF Clone in Cloning Vector, Rat RG80853-U
AKIP/AURKAIP1 cDNA ORF Clone in Cloning Vector, Rat RG8A6876-U
AKIP/AURKAIP1 cDNA ORF Clone, Rat, untagged RG80853-UT
AKIP/AURKAIP1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A6876-ACGLN
AKIP/AURKAIP1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80853-ACGLN
AKIP/AURKAIP1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80853-ACG
AKIP/AURKAIP1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80853-ANG
AKIP/AURKAIP1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80853-ACR
AKIP/AURKAIP1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80853-ANR
AKIP/AURKAIP1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80853-CF
AKIP/AURKAIP1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80853-NF
AKIP/AURKAIP1 cDNA ORF Clone, Rat, C-His tag RG80853-CH
AKIP/AURKAIP1 cDNA ORF Clone, Rat, N-His tag RG80853-NH
AKIP/AURKAIP1 cDNA ORF Clone, Rat, C-HA tag RG80853-CY
AKIP/AURKAIP1 cDNA ORF Clone, Rat, N-HA tag RG80853-NY
AKIP/AURKAIP1 cDNA ORF Clone, Rat, C-Myc tag RG80853-CM
AKIP/AURKAIP1 qPCR Primer Pairs, Rat RP300817

AKIP/AURKAIP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
AKIP/AURKAIP1 cDNA ORF Clone in Cloning Vector, Human HG21274-U
AKIP/AURKAIP1 cDNA ORF Clone, Human, untagged HG21274-UT
AKIP/AURKAIP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG21274-ACGLN
AKIP/AURKAIP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG21274-ACG
AKIP/AURKAIP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG21274-ANG
AKIP/AURKAIP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG21274-ACR
AKIP/AURKAIP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG21274-ANR
AKIP/AURKAIP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG21274-CF
AKIP/AURKAIP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG21274-NF
AKIP/AURKAIP1 cDNA ORF Clone, Human, C-His tag HG21274-CH
AKIP/AURKAIP1 cDNA ORF Clone, Human, N-His tag HG21274-NH
AKIP/AURKAIP1 cDNA ORF Clone, Human, C-HA tag HG21274-CY
AKIP/AURKAIP1 cDNA ORF Clone, Human, N-HA tag HG21274-NY
AKIP/AURKAIP1 cDNA ORF Clone, Human, C-Myc tag HG21274-CM
AKIP/AURKAIP1 cDNA ORF Clone, Human, N-Myc tag HG21274-NM
info info
添加购物车成功! 添加购物车失败!