ATP6V1G2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81318-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ATP6V1G2 Reagents
CRO Services
Product recommended

All ATP6V1G2 Reagents
ATP6V1G2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
357 bp
Description
Full length Clone DNA of Rat ATPase, H+ transporting, lysosomal V1 subunit G2 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ATP6V1G2 Background Information
Full Name
ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2

ATP6V1G2 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
ATP6V1G2 cDNA ORF Clone in Cloning Vector, Canine DG70180-U
ATP6V1G2 cDNA ORF Clone, Canine, untagged DG70180-UT
ATP6V1G2 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70180-ACGLN
ATP6V1G2 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70180-ACG
ATP6V1G2 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70180-ANG
ATP6V1G2 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70180-ACR
ATP6V1G2 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70180-ANR
ATP6V1G2 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70180-CF
ATP6V1G2 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70180-NF
ATP6V1G2 cDNA ORF Clone, Canine, C-His tag DG70180-CH
ATP6V1G2 cDNA ORF Clone, Canine, N-His tag DG70180-NH
ATP6V1G2 cDNA ORF Clone, Canine, C-HA tag DG70180-CY
ATP6V1G2 cDNA ORF Clone, Canine, N-HA tag DG70180-NY
ATP6V1G2 cDNA ORF Clone, Canine, C-Myc tag DG70180-CM
ATP6V1G2 cDNA ORF Clone, Canine, N-Myc tag DG70180-NM

ATP6V1G2 cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
ATP6V1G2 cDNA ORF Clone in Cloning Vector, Rabbit TG65121-G
ATP6V1G2 cDNA ORF Clone, Rabbit, untagged TG65121-UT
ATP6V1G2 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65121-ACG
ATP6V1G2 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65121-ANG
ATP6V1G2 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65121-ACR
ATP6V1G2 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65121-ANR
ATP6V1G2 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65121-CF
ATP6V1G2 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65121-NF
ATP6V1G2 cDNA ORF Clone, Rabbit, C-His tag TG65121-CH
ATP6V1G2 cDNA ORF Clone, Rabbit, N-His tag TG65121-NH
ATP6V1G2 cDNA ORF Clone, Rabbit, C-HA tag TG65121-CY
ATP6V1G2 cDNA ORF Clone, Rabbit, N-HA tag TG65121-NY
ATP6V1G2 cDNA ORF Clone, Rabbit, C-Myc tag TG65121-CM
ATP6V1G2 cDNA ORF Clone, Rabbit, N-Myc tag TG65121-NM

ATP6V1G2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ATP6V1G2 cDNA ORF Clone in Cloning Vector, Rat RG81318-G
ATP6V1G2 cDNA ORF Clone, Rat, untagged RG81318-UT
ATP6V1G2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81318-ACGLN
ATP6V1G2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81318-ACG
ATP6V1G2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81318-ANG
ATP6V1G2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81318-ACR
ATP6V1G2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81318-ANR
ATP6V1G2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81318-NF
ATP6V1G2 cDNA ORF Clone, Rat, C-His tag RG81318-CH
ATP6V1G2 cDNA ORF Clone, Rat, N-His tag RG81318-NH
ATP6V1G2 cDNA ORF Clone, Rat, C-HA tag RG81318-CY
ATP6V1G2 cDNA ORF Clone, Rat, N-HA tag RG81318-NY
ATP6V1G2 cDNA ORF Clone, Rat, C-Myc tag RG81318-CM
ATP6V1G2 cDNA ORF Clone, Rat, N-Myc tag RG81318-NM
ATP6V1G2 qPCR Primer Pairs, Rat RP301289

ATP6V1G2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ATP6V1G2 cDNA ORF Clone in Cloning Vector, Mouse MG53355-U
ATP6V1G2 cDNA ORF Clone, Mouse, untagged MG53355-UT
ATP6V1G2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53355-ACGLN
ATP6V1G2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53355-ACG
ATP6V1G2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53355-ANG
ATP6V1G2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53355-ACR
ATP6V1G2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53355-ANR
ATP6V1G2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53355-CF
ATP6V1G2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53355-NF
ATP6V1G2 cDNA ORF Clone, Mouse, C-His tag MG53355-CH
ATP6V1G2 cDNA ORF Clone, Mouse, N-His tag MG53355-NH
ATP6V1G2 cDNA ORF Clone, Mouse, C-HA tag MG53355-CY
ATP6V1G2 cDNA ORF Clone, Mouse, N-HA tag MG53355-NY
ATP6V1G2 cDNA ORF Clone, Mouse, C-Myc tag MG53355-CM
ATP6V1G2 cDNA ORF Clone, Mouse, N-Myc tag MG53355-NM
info info
添加购物车成功! 添加购物车失败!