ATP6V0D1/VPATPD cDNA ORF Clone, Rat, N-HA tag

Cat: RG80625-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ATP6V0D1/VPATPD Reagents
CRO Services
Product recommended

All ATP6V0D1/VPATPD Reagents
ATP6V0D1/VPATPD cDNA ORF Clone, Rat, N-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1056 bp
Description
Full length Clone DNA of Rat ATPase, H+ transporting, lysosomal V0 subunit D1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ATP6V0D1/VPATPD Background Information
Full Name
ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1

ATP6V0D1/VPATPD cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
ATP6V0D1/VPATPD cDNA ORF Clone in Cloning Vector, Ferret FG60140-G
ATP6V0D1/VPATPD cDNA ORF Clone, Ferret, untagged FG60140-UT
ATP6V0D1/VPATPD Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60140-ACGLN
ATP6V0D1/VPATPD cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60140-ACG
ATP6V0D1/VPATPD cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60140-ANG
ATP6V0D1/VPATPD cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60140-ACR
ATP6V0D1/VPATPD cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60140-ANR
ATP6V0D1/VPATPD cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60140-CF
ATP6V0D1/VPATPD cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60140-NF
ATP6V0D1/VPATPD cDNA ORF Clone, Ferret, C-His tag FG60140-CH
ATP6V0D1/VPATPD cDNA ORF Clone, Ferret, N-His tag FG60140-NH
ATP6V0D1/VPATPD cDNA ORF Clone, Ferret, C-HA tag FG60140-CY
ATP6V0D1/VPATPD cDNA ORF Clone, Ferret, N-HA tag FG60140-NY
ATP6V0D1/VPATPD cDNA ORF Clone, Ferret, C-Myc tag FG60140-CM
ATP6V0D1/VPATPD cDNA ORF Clone, Ferret, N-Myc tag FG60140-NM

ATP6V0D1/VPATPD cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
ATP6V0D1/VPATPD cDNA ORF Clone in Cloning Vector, Cynomolgus CG90337-G
ATP6V0D1/VPATPD cDNA ORF Clone, Cynomolgus, untagged CG90337-UT
ATP6V0D1/VPATPD Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90337-ACGLN
ATP6V0D1/VPATPD cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90337-ACG
ATP6V0D1/VPATPD cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90337-ANG
ATP6V0D1/VPATPD cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90337-ACR
ATP6V0D1/VPATPD cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90337-ANR
ATP6V0D1/VPATPD cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90337-CF
ATP6V0D1/VPATPD cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90337-NF
ATP6V0D1/VPATPD cDNA ORF Clone, Cynomolgus, C-His tag CG90337-CH
ATP6V0D1/VPATPD cDNA ORF Clone, Cynomolgus, N-His tag CG90337-NH
ATP6V0D1/VPATPD cDNA ORF Clone, Cynomolgus, C-HA tag CG90337-CY
ATP6V0D1/VPATPD cDNA ORF Clone, Cynomolgus, N-HA tag CG90337-NY
ATP6V0D1/VPATPD cDNA ORF Clone, Cynomolgus, C-Myc tag CG90337-CM
ATP6V0D1/VPATPD cDNA ORF Clone, Cynomolgus, N-Myc tag CG90337-NM

ATP6V0D1/VPATPD cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ATP6V0D1/VPATPD cDNA ORF Clone in Cloning Vector, Rat RG80625-U
ATP6V0D1/VPATPD cDNA ORF Clone, Rat, untagged RG80625-UT
ATP6V0D1/VPATPD cDNA ORF Clone, Rat, C-GFPSpark® tag RG80625-ACG
ATP6V0D1/VPATPD Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80625-ACGLN
ATP6V0D1/VPATPD cDNA ORF Clone, Rat, N-GFPSpark® tag RG80625-ANG
ATP6V0D1/VPATPD cDNA ORF Clone, Rat, C-OFPSpark® tag RG80625-ACR
ATP6V0D1/VPATPD cDNA ORF Clone, Rat, N-OFPSpark® tag RG80625-ANR
ATP6V0D1/VPATPD cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80625-CF
ATP6V0D1/VPATPD cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80625-NF
ATP6V0D1/VPATPD cDNA ORF Clone, Rat, C-His tag RG80625-CH
ATP6V0D1/VPATPD cDNA ORF Clone, Rat, N-His tag RG80625-NH
ATP6V0D1/VPATPD cDNA ORF Clone, Rat, C-HA tag RG80625-CY
ATP6V0D1/VPATPD cDNA ORF Clone, Rat, C-Myc tag RG80625-CM
ATP6V0D1/VPATPD cDNA ORF Clone, Rat, N-Myc tag RG80625-NM
ATP6V0D1/VPATPD qPCR Primer Pairs, Rat RP300589

ATP6V0D1/VPATPD cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ATP6V0D1/VPATPD cDNA ORF Clone in Cloning Vector, Mouse MG51284-U
ATP6V0D1/VPATPD cDNA ORF Clone, Mouse, untagged MG51284-UT
ATP6V0D1/VPATPD cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51284-ACG
ATP6V0D1/VPATPD Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51284-ACGLN
ATP6V0D1/VPATPD cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51284-ACR
ATP6V0D1/VPATPD cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51284-CF
ATP6V0D1/VPATPD cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51284-NF
ATP6V0D1/VPATPD cDNA ORF Clone, Mouse, C-His tag MG51284-CH
ATP6V0D1/VPATPD cDNA ORF Clone, Mouse, N-His tag MG51284-NH
ATP6V0D1/VPATPD cDNA ORF Clone, Mouse, C-HA tag MG51284-CY
ATP6V0D1/VPATPD cDNA ORF Clone, Mouse, N-HA tag MG51284-NY
ATP6V0D1/VPATPD cDNA ORF Clone, Mouse, C-Myc tag MG51284-CM
ATP6V0D1/VPATPD cDNA ORF Clone, Mouse, N-Myc tag MG51284-NM
ATP6V0D1/VPATPD qPCR Primer Pairs, Mouse MP201166

ATP6V0D1/VPATPD cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ATP6V0D1/VPATPD cDNA ORF Clone in Cloning Vector, Human HG16156-G
ATP6V0D1/VPATPD cDNA ORF Clone, Human, untagged HG16156-UT
ATP6V0D1/VPATPD cDNA ORF Clone, Human, C-GFPSpark® tag HG16156-ACG
ATP6V0D1/VPATPD Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16156-ACGLN
ATP6V0D1/VPATPD cDNA ORF Clone, Human, C-OFPSpark® tag HG16156-ACR
ATP6V0D1/VPATPD cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16156-CF
ATP6V0D1/VPATPD cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16156-NF
ATP6V0D1/VPATPD cDNA ORF Clone, Human, C-His tag HG16156-CH
ATP6V0D1/VPATPD cDNA ORF Clone, Human, N-His tag HG16156-NH
ATP6V0D1/VPATPD cDNA ORF Clone, Human, C-HA tag HG16156-CY
ATP6V0D1/VPATPD cDNA ORF Clone, Human, N-HA tag HG16156-NY
ATP6V0D1/VPATPD cDNA ORF Clone, Human, C-Myc tag HG16156-CM
ATP6V0D1/VPATPD cDNA ORF Clone, Human, N-Myc tag HG16156-NM
ATP6V0D1/VPATPD qPCR Primer Pairs, Human HP104925
info info
添加购物车成功! 添加购物车失败!