ASF1B cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80892-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ASF1B Reagents
CRO Services
Product recommended

All ASF1B Reagents
ASF1B cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
609 bp
Description
Full length Clone DNA of Rat ASF1 anti-silencing function 1 homolog B (S. cerevisiae) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ASF1B Background Information
Full Name
anti-silencing function 1B histone chaperone

ASF1B cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ASF1B cDNA ORF Clone in Cloning Vector, Rat RG80892-U
ASF1B cDNA ORF Clone, Rat, untagged RG80892-UT
ASF1B cDNA ORF Clone, Rat, C-GFPSpark® tag RG80892-ACG
ASF1B Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80892-ACGLN
ASF1B cDNA ORF Clone, Rat, N-GFPSpark® tag RG80892-ANG
ASF1B cDNA ORF Clone, Rat, C-OFPSpark® tag RG80892-ACR
ASF1B cDNA ORF Clone, Rat, N-OFPSpark® tag RG80892-ANR
ASF1B cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80892-CF
ASF1B cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80892-NF
ASF1B cDNA ORF Clone, Rat, C-His tag RG80892-CH
ASF1B cDNA ORF Clone, Rat, N-His tag RG80892-NH
ASF1B cDNA ORF Clone, Rat, C-HA tag RG80892-CY
ASF1B cDNA ORF Clone, Rat, N-HA tag RG80892-NY
ASF1B cDNA ORF Clone, Rat, C-Myc tag RG80892-CM
ASF1B qPCR Primer Pairs, Rat RP300856

ASF1B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ASF1B cDNA ORF Clone in Cloning Vector, Human HG14382-G
ASF1B cDNA ORF Clone, Human, untagged HG14382-UT
ASF1B cDNA ORF Clone, Human, C-GFPSpark® tag HG14382-ACG
ASF1B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14382-ACGLN
ASF1B cDNA ORF Clone, Human, N-GFPSpark® tag HG14382-ANG
ASF1B cDNA ORF Clone, Human, C-OFPSpark® tag HG14382-ACR
ASF1B cDNA ORF Clone, Human, N-OFPSpark® tag HG14382-ANR
ASF1B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14382-CF
ASF1B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14382-NF
ASF1B cDNA ORF Clone, Human, C-His tag HG14382-CH
ASF1B cDNA ORF Clone, Human, N-His tag HG14382-NH
ASF1B cDNA ORF Clone, Human, C-HA tag HG14382-CY
ASF1B cDNA ORF Clone, Human, N-HA tag HG14382-NY
ASF1B cDNA ORF Clone, Human, C-Myc tag HG14382-CM
ASF1B cDNA ORF Clone, Human, N-Myc tag HG14382-NM
ASF1B qPCR Primer Pairs, Human HP103031
info info
添加购物车成功! 添加购物车失败!