ASCC1 cDNA ORF Clone, Rat, C-Myc tag

Cat: RG81108-CM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All ASCC1 Reagents

CRO Services

Product recommended


All ASCC1 Reagents

ASCC1 cDNA ORF Clone, Rat, C-Myc tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1071 bp
Description
Full length Clone DNA of Rat activating signal cointegrator 1 complex subunit 1 with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ASCC1 Background Information

Full Name
activating signal cointegrator 1 complex subunit 1

ASCC1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ASCC1 cDNA ORF Clone in Cloning Vector, Rat RG81108-U
ASCC1 cDNA ORF Clone, Rat, untagged RG81108-UT
ASCC1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81108-ACGLN
ASCC1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81108-ACG
ASCC1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81108-ANG
ASCC1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81108-ACR
ASCC1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81108-ANR
ASCC1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81108-CF
ASCC1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81108-NF
ASCC1 cDNA ORF Clone, Rat, C-His tag RG81108-CH
ASCC1 cDNA ORF Clone, Rat, N-His tag RG81108-NH
ASCC1 cDNA ORF Clone, Rat, C-HA tag RG81108-CY
ASCC1 cDNA ORF Clone, Rat, N-HA tag RG81108-NY
ASCC1 cDNA ORF Clone, Rat, N-Myc tag RG81108-NM
ASCC1 qPCR Primer Pairs, Rat RP301065

ASCC1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ASCC1 cDNA ORF Clone in Cloning Vector, Mouse MG51587-G
ASCC1 cDNA ORF Clone, Mouse, untagged MG51587-UT
ASCC1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51587-ACG
ASCC1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51587-ACGLN
ASCC1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51587-ANG
ASCC1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51587-ACR
ASCC1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51587-ANR
ASCC1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51587-CF
ASCC1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51587-NF
ASCC1 cDNA ORF Clone, Mouse, C-His tag MG51587-CH
ASCC1 cDNA ORF Clone, Mouse, N-His tag MG51587-NH
ASCC1 cDNA ORF Clone, Mouse, C-HA tag MG51587-CY
ASCC1 cDNA ORF Clone, Mouse, N-HA tag MG51587-NY
ASCC1 cDNA ORF Clone, Mouse, C-Myc tag MG51587-CM
ASCC1 cDNA ORF Clone, Mouse, N-Myc tag MG51587-NM
ASCC1 qPCR Primer Pairs, Mouse MP201470

ASCC1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ASCC1 cDNA ORF Clone in Cloning Vector, Human HG14183-G
ASCC1 cDNA ORF Clone, Human, untagged HG14183-UT
ASCC1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14183-ACG
ASCC1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14183-ACGLN
ASCC1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14183-ANG
ASCC1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14183-ACR
ASCC1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14183-ANR
ASCC1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14183-CF
ASCC1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14183-NF
ASCC1 cDNA ORF Clone, Human, C-His tag HG14183-CH
ASCC1 cDNA ORF Clone, Human, N-His tag HG14183-NH
ASCC1 cDNA ORF Clone, Human, C-HA tag HG14183-CY
ASCC1 cDNA ORF Clone, Human, N-HA tag HG14183-NY
ASCC1 cDNA ORF Clone, Human, C-Myc tag HG14183-CM
ASCC1 cDNA ORF Clone, Human, N-Myc tag HG14183-NM
ASCC1 qPCR Primer Pairs, Human HP102834
info info
添加购物车成功! 添加购物车失败!