ART1 cDNA ORF Clone, Rat, C-His tag

Cat: RG80382-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ART1 Reagents
CRO Services
Product recommended

All ART1 Reagents
ART1 cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
966 bp
Description
Full length Clone DNA of Rat ADP-ribosyltransferase 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ART1 Background Information
Full Name
ADP-ribosyltransferase 1

ART1 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
ART1 cDNA ORF Clone in Cloning Vector, Rhesus CG90271-G
ART1 cDNA ORF Clone, Rhesus, untagged CG90271-UT
ART1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90271-ACGLN
ART1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90271-ACG
ART1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90271-ACR
ART1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90271-CF
ART1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90271-NF
ART1 cDNA ORF Clone, Rhesus, C-His tag CG90271-CH
ART1 cDNA ORF Clone, Rhesus, N-His tag CG90271-NH
ART1 cDNA ORF Clone, Rhesus, C-HA tag CG90271-CY
ART1 cDNA ORF Clone, Rhesus, N-HA tag CG90271-NY
ART1 cDNA ORF Clone, Rhesus, C-Myc tag CG90271-CM
ART1 cDNA ORF Clone, Rhesus, N-Myc tag CG90271-NM

ART1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ART1 cDNA ORF Clone in Cloning Vector, Rat RG80382-G
ART1 cDNA ORF Clone, Rat, untagged RG80382-UT
ART1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80382-ACGLN
ART1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80382-ACG
ART1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80382-ACR
ART1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80382-CF
ART1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80382-NF
ART1 cDNA ORF Clone, Rat, N-His tag RG80382-NH
ART1 cDNA ORF Clone, Rat, C-HA tag RG80382-CY
ART1 cDNA ORF Clone, Rat, N-HA tag RG80382-NY
ART1 cDNA ORF Clone, Rat, C-Myc tag RG80382-CM
ART1 cDNA ORF Clone, Rat, N-Myc tag RG80382-NM
ART1 qPCR Primer Pairs, Rat RP300349

ART1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ART1 cDNA ORF Clone in Cloning Vector, Mouse MG50988-G
ART1 cDNA ORF Clone, Mouse, untagged MG50988-UT
ART1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50988-ACGLN
ART1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50988-ACG
ART1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50988-ACR
ART1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50988-CF
ART1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50988-NF
ART1 cDNA ORF Clone, Mouse, C-His tag MG50988-CH
ART1 cDNA ORF Clone, Mouse, N-His tag MG50988-NH
ART1 cDNA ORF Clone, Mouse, C-HA tag MG50988-CY
ART1 cDNA ORF Clone, Mouse, N-HA tag MG50988-NY
ART1 cDNA ORF Clone, Mouse, C-Myc tag MG50988-CM
ART1 cDNA ORF Clone, Mouse, N-Myc tag MG50988-NM
ART1 qPCR Primer Pairs, Mouse MP200954
info info
添加购物车成功! 添加购物车失败!