ARPC1A cDNA ORF Clone, Rat, N-HA tag

Cat: RG80524-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ARPC1A Reagents
CRO Services
Product recommended

All ARPC1A Reagents
ARPC1A cDNA ORF Clone, Rat, N-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1155 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 234C/T,387T/C not causing the amino acid variation.
Description
Full length Clone DNA of Rat actin related protein 2/3 complex, subunit 1A with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Restriction Sites
KpnI + NotI(6kb+1.16kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
ARPC1A cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ARPC1A cDNA ORF Clone, Rat, N-HA tag Validated Images
Human Bcl2A1/Bfl-1 Gene Plasmid Map 5728
Rat ARPC1A Gene Expression validated Image 16717
The plasmid was transfected into 293FT adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-HA Tag monoclonal antibody (100028-MM10) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
ARPC1A Background Information
Full Name
actin related protein 2/3 complex, subunit 1A, 41kDa

ARPC1A cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ARPC1A cDNA ORF Clone in Cloning Vector, Rat RG80524-U
ARPC1A cDNA ORF Clone, Rat, untagged RG80524-UT
ARPC1A cDNA ORF Clone, Rat, C-GFPSpark® tag RG80524-ACG
ARPC1A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80524-ACGLN
ARPC1A cDNA ORF Clone, Rat, N-GFPSpark® tag RG80524-ANG
ARPC1A cDNA ORF Clone, Rat, C-OFPSpark® tag RG80524-ACR
ARPC1A cDNA ORF Clone, Rat, N-OFPSpark® tag RG80524-ANR
ARPC1A cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80524-CF
ARPC1A cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80524-NF
ARPC1A cDNA ORF Clone, Rat, C-His tag RG80524-CH
ARPC1A cDNA ORF Clone, Rat, N-His tag RG80524-NH
ARPC1A cDNA ORF Clone, Rat, C-HA tag RG80524-CY
ARPC1A cDNA ORF Clone, Rat, C-Myc tag RG80524-CM
ARPC1A cDNA ORF Clone, Rat, N-Myc tag RG80524-NM
ARPC1A qPCR Primer Pairs, Rat RP300488

ARPC1A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ARPC1A cDNA ORF Clone in Cloning Vector, Mouse MG51503-U
ARPC1A cDNA ORF Clone, Mouse, untagged MG51503-UT
ARPC1A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51503-ACG
ARPC1A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51503-ACGLN
ARPC1A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51503-ANG
ARPC1A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51503-ACR
ARPC1A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51503-ANR
ARPC1A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51503-CF
ARPC1A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51503-NF
ARPC1A cDNA ORF Clone, Mouse, C-His tag MG51503-CH
ARPC1A cDNA ORF Clone, Mouse, N-His tag MG51503-NH
ARPC1A cDNA ORF Clone, Mouse, C-HA tag MG51503-CY
ARPC1A cDNA ORF Clone, Mouse, N-HA tag MG51503-NY
ARPC1A cDNA ORF Clone, Mouse, C-Myc tag MG51503-CM
ARPC1A cDNA ORF Clone, Mouse, N-Myc tag MG51503-NM
ARPC1A qPCR Primer Pairs, Mouse MP201387

ARPC1A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ARPC1A cDNA ORF Clone in Cloning Vector, Human HG15172-G
ARPC1A cDNA ORF Clone, Human, untagged HG15172-UT
ARPC1A cDNA ORF Clone, Human, C-GFPSpark® tag HG15172-ACG
ARPC1A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15172-ACGLN
ARPC1A cDNA ORF Clone, Human, N-GFPSpark® tag HG15172-ANG
ARPC1A cDNA ORF Clone, Human, C-OFPSpark® tag HG15172-ACR
ARPC1A cDNA ORF Clone, Human, N-OFPSpark® tag HG15172-ANR
ARPC1A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15172-CF
ARPC1A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15172-NF
ARPC1A cDNA ORF Clone, Human, C-His tag HG15172-CH
ARPC1A cDNA ORF Clone, Human, N-His tag HG15172-NH
ARPC1A cDNA ORF Clone, Human, C-HA tag HG15172-CY
ARPC1A cDNA ORF Clone, Human, N-HA tag HG15172-NY
ARPC1A cDNA ORF Clone, Human, C-Myc tag HG15172-CM
ARPC1A cDNA ORF Clone, Human, N-Myc tag HG15172-NM
ARPC1A qPCR Primer Pairs, Human HP103799
info info
添加购物车成功! 添加购物车失败!