APOBEC2 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80791-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All APOBEC2 Reagents
CRO Services
Product recommended

All APOBEC2 Reagents
APOBEC2 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
675 bp
Description
Full length Clone DNA of Rat apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 2 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

APOBEC2 Background Information
Full Name
apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 2

APOBEC2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
APOBEC2 cDNA ORF Clone in Cloning Vector, Rat RG80791-U
APOBEC2 cDNA ORF Clone, Rat, untagged RG80791-UT
APOBEC2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80791-ACG
APOBEC2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80791-ACGLN
APOBEC2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80791-ANG
APOBEC2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80791-ACR
APOBEC2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80791-ANR
APOBEC2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80791-CF
APOBEC2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80791-NF
APOBEC2 cDNA ORF Clone, Rat, C-His tag RG80791-CH
APOBEC2 cDNA ORF Clone, Rat, N-His tag RG80791-NH
APOBEC2 cDNA ORF Clone, Rat, C-HA tag RG80791-CY
APOBEC2 cDNA ORF Clone, Rat, N-HA tag RG80791-NY
APOBEC2 cDNA ORF Clone, Rat, C-Myc tag RG80791-CM
APOBEC2 qPCR Primer Pairs, Rat RP300755

APOBEC2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
APOBEC2 cDNA ORF Clone in Cloning Vector, Human HG10399-M
APOBEC2 cDNA ORF Clone, Human, untagged HG10399-UT
APOBEC2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10399-ACG
APOBEC2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10399-ACGLN
APOBEC2 cDNA ORF Clone, Human, N-GFPSpark® tag HG10399-ANG
APOBEC2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10399-ACR
APOBEC2 cDNA ORF Clone, Human, N-OFPSpark® tag HG10399-ANR
APOBEC2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10399-CF
APOBEC2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10399-NF
APOBEC2 cDNA ORF Clone, Human, C-His tag HG10399-CH
APOBEC2 cDNA ORF Clone, Human, N-His tag HG10399-NH
APOBEC2 cDNA ORF Clone, Human, C-HA tag HG10399-CY
APOBEC2 cDNA ORF Clone, Human, N-HA tag HG10399-NY
APOBEC2 cDNA ORF Clone, Human, C-Myc tag HG10399-CM
APOBEC2 cDNA ORF Clone, Human, N-Myc tag HG10399-NM
APOBEC2 qPCR Primer Pairs, Human HP100430
info info
添加购物车成功! 添加购物车失败!