APH1A cDNA ORF Clone, Rat, N-HA tag

Cat: RG80589-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All APH1A Reagents
CRO Services
Product recommended

All APH1A Reagents
APH1A cDNA ORF Clone, Rat, N-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
744 bp
Description
Full length Clone DNA of Rat APH1A gamma secretase subunit with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

APH1A Background Information
Full Name
APH1A gamma secretase subunit

APH1A cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
APH1A cDNA ORF Clone in Cloning Vector, Rat RG80589-U
APH1A cDNA ORF Clone, Rat, untagged RG80589-UT
APH1A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80589-ACGLN
APH1A cDNA ORF Clone, Rat, C-GFPSpark® tag RG80589-ACG
APH1A cDNA ORF Clone, Rat, C-OFPSpark® tag RG80589-ACR
APH1A cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80589-CF
APH1A cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80589-NF
APH1A cDNA ORF Clone, Rat, C-His tag RG80589-CH
APH1A cDNA ORF Clone, Rat, N-His tag RG80589-NH
APH1A cDNA ORF Clone, Rat, C-HA tag RG80589-CY
APH1A cDNA ORF Clone, Rat, C-Myc tag RG80589-CM
APH1A cDNA ORF Clone, Rat, N-Myc tag RG80589-NM
APH1A qPCR Primer Pairs, Rat RP300553

APH1A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
APH1A cDNA ORF Clone in Cloning Vector, Human HG16271-G
APH1A cDNA ORF Clone, Human, untagged HG16271-UT
APH1A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16271-ACGLN
APH1A cDNA ORF Clone, Human, C-GFPSpark® tag HG16271-ACG
APH1A cDNA ORF Clone, Human, C-OFPSpark® tag HG16271-ACR
APH1A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16271-CF
APH1A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16271-NF
APH1A cDNA ORF Clone, Human, C-His tag HG16271-CH
APH1A cDNA ORF Clone, Human, N-His tag HG16271-NH
APH1A cDNA ORF Clone, Human, C-HA tag HG16271-CY
APH1A cDNA ORF Clone, Human, N-HA tag HG16271-NY
APH1A cDNA ORF Clone, Human, C-Myc tag HG16271-CM
APH1A cDNA ORF Clone, Human, N-Myc tag HG16271-NM
info info
添加购物车成功! 添加购物车失败!